Stipa tirsa

Steven · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Stipa

At a glance

Occurrence records1 470

Data sources10

Biological traits25

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Stipa tirsa's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 470 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF1 470 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Stipa tirsa is a species of perennial grass native to Europe and temperate Asia. Culms are 40–100 cm long; leaf blades are filiform, involute, and 1–2 mm wide.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLEDAGIFTWCVPTRY

Size & morphology4

Plant height0.575 m

Plant height max1 m

Plant height min0.3 m

Seed mass16.41 mg

Life cycle & reproduction10

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typeanimal

Flowering endJul

Flowering startJun

Life formperennial

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: graminoid

Habitat GIFTmeadows, meadows: wet, saline places, sand, steppe

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typefruit with appendage

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stipa tirsa has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences5

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK561531.1 ↗599 bpRussia · 2009

ACGT

TGTCGTGACCCTGACCAAAACAGACCGCGCACGCGTCACCCATCCCGCCGGCGGCGGCACCGCCCGCCGTCCGGCCAAGTCCCCGACCAC …

Stipa tirsa voucher MW0225114 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Stipa tirsa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–442n range44median44mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 444×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-northern-plants +1

CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.

CCDB · ipcn-api-dl

CCDB · book-northern-plants — Avdulov 1931.

CCDB · Original-count — Winterfeld, G., Schneider, J., Becher, H., Dickie, J., Röser, M. (2015). Karyosystematics of the Australasian stipoid grass Austrostipa and related genera: chromosome sizes, ploidy, chromosome base numbers, and phylogeny. Austral. Syst. Bot. 28: 145–159. doi: /10.1071/SB14066

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 470 records

Wild obs. + sensor777

Museum / vouchered685

Cultivated / captive1

Other7

Range

Area of Occupancy AOO2 836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 161≤1 km 140≤10 km 63>10 km 83

447 georeferenced · 330 without coordinates

Open the mapobservation + sensor777

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 25≤1 km 177≤10 km 115>10 km 9

326 georeferenced · 359 without coordinates

Open the institutions mapphysical evidence685

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	306
BRNUlocation not on record	128
LDlocation not on record	36
Oskarshamn, SE	21
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	15
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	14
Wlocation not on record	7
PRClocation not on record	4
GJOlocation not on record	3
SLU Artdatabankenlocation not on record	3
Denver, US	2
The State Museum-Preserve "The Kulikovo pole"location not on record	2
Saint Louis, US	2
Dresden, DE	2
MAlocation not on record	2
BFLlocation not on record	1
Berlin, DE	1
CICYTEXlocation not on record	1
Zürich, CH	1
Görlitz, DE	1
Logan, US	1
Bloomington, US	1
BG-NMNHSlocation not on record	1
LfUlocation not on record	1
Tula State Universitylocation not on record	1

25 institutions · 557 of 685 vouchered records shown · 125 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Stipa tirsa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C -0.1–8.30

Seasonal swing summer↔winter17.7 °C

Max temp (day)11.9 °C 3.80–11.9

Min temp (night)4.60 °C -4.70–4.60

Precipitation58.1 mm/mo 40.9–58.1

Air humidity64.0 % 61.1–64.0

Moisture balance-4.10 mm/mo -8.90–-4.10

Vapour deficit449 Pa 381–449

Wind speed3.70 m/s 2.50–3.70

Cloud cover41.9 % 41.9–55.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stipa tirsa

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction10

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 470 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 470 records