Stipa pulcherrima

K.Koch · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Stipa

At a glance

Occurrence records3 109

Data sources11

Biological traits33

DNA specimens9

eDNA detections65

Sources11 archives

Databases and archives Stipa pulcherrima's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 109 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF3 109 records

Environmental DNA2 datasets · 2 countries65 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Stipa pulcherrima, golden feather grass is a bisexual flowering plant in the family Poaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology7

Leaf mass55.06 mg

Leaf size541 mm²

Plant height0.6 m

Plant height generative0.75 m

Plant height max1 m

Plant height min0.3 m

Seed mass25.38 mg

Life cycle & reproduction11

Deciduousnessaestival

Dispersal typeanimal

⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous

Flowering endJun

Flowering startMay

Life formperennial

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Seed number72

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 100 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: graminoid

Habitat GIFTmountains

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)568 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)10.09 mm²/mg

⚠ sources differ — TRY: 10.09 mm²/mg · LEDA: 8.38 mm²/mg · GIFT: 8.38 mm²/mg

Other traits1

Diaspore typeone-seeded generative dispersule

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stipa pulcherrima has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences4

eDNA detections65

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMK551330.1 ↗598 bpRussia · 2014

ACGT

TGTCGTGACCCTGACCAAAACAGACCGCGCACGCGTCACCCATCCCGCCGGCGGCGGCACCGCCCGCCGTCCGGCCAAGTCCCCGACCAC …

Stipa pulcherrima voucher Alt14-624 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Stipa pulcherrima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–662n range44median44mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 444×CCDB · ita-fl · CCDB · ipcn-api-dl

CCDB · ita-fl — MORALDO B. - 1986. Il genere Stipa L. (Gramineae) In Italia.. Webbia , 40(2): 203-278.

CCDB · ipcn-api-dl — Baden, C. 1983. Chromosome numbers in some Greek angiosperms. Willdenowia 13: 335–336.

CCDB · ipcn-api-dl — Strid, A. & I. A. Andersson. 1985. Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203–228.

CCDB · ipcn-api-dl

2n 661×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 109 records

Wild obs. + sensor1 722

Museum / vouchered1 160

Other227

Range

Area of Occupancy AOO5 592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 220≤1 km 236≤10 km 164>10 km 107

727 georeferenced · 995 without coordinates

Open the mapobservation + sensor1 722

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 52≤1 km 282≤10 km 180>10 km 70

584 georeferenced · 576 without coordinates

Open the institutions mapphysical evidence1 160

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 50 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	394
BRNUlocation not on record	180
KFGBlocation not on record	65
LDlocation not on record	27
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	24
BFLlocation not on record	20
PRClocation not on record	19
Wlocation not on record	14
Uniwersytet Wrocławskilocation not on record	14
Dresden, DE	11
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	11
CJBGlocation not on record	9
Provincia di Livornolocation not on record	8
Jagiellonian Universitylocation not on record	7
Kostrzyca Forest Gene Banklocation not on record	6
The State Museum-Preserve "The Kulikovo pole"location not on record	6
University of Stellenboschlocation not on record	6
Regensburgische Botanische Gesellschaftlocation not on record	4
València, ES	3
South Kensington, GB	3
Salamanca, ES	3
Frankfurt am Main	3
Berlin, DE	3
BClocation not on record	3
Oskarshamn, SE	2
Görlitz, DE	2
Uppsala, SE	2
Adam Mickiewicz University in Poznańlocation not on record	2
Kew, GB	2
BG-NMNHSlocation not on record	2
Logan, US	2
Samara National Research Universitylocation not on record	2
MAlocation not on record	2
Zürich, CH	1
Universität Göttingenlocation not on record	1
PRlocation not on record	1
CICYTEXlocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
ER-Gaucklocation not on record	1
Elocation not on record	1
Saint Louis, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
GJOlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
NoColllocation not on record	1
BMlocation not on record	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Warsaw, PL	1
MeiseBGlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

50 institutions · 878 of 1 160 vouchered records shown · 281 without an institution code

09Environmental DNA65 detections

Where the DNA of Stipa pulcherrima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 15.4–16.0

Seasonal swing summer↔winter19.7 °C

Max temp (day)19.8 °C 19.5–19.8

Min temp (night)11.2 °C 11.1–11.2

Precipitation180 mm/mo 76.7–180

Air humidity61.9 % 60.5–61.9

Moisture balance69.9 mm/mo -40.1–69.9

Vapour deficit694 Pa 693–694

Wind speed2.00 m/s 2.00–4.00

Cloud cover29.9 % 29.9–36.6

CHELSA 1981–2010, ~9 km grid, at location & month of 65 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stipa pulcherrima

At a glance

Sources11 archives

Size & morphology7

Life cycle & reproduction11

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 109 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 50 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 109 records