Stipa lessingiana

Trin. & Rupr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Stipa

At a glance

Occurrence records4 232

Data sources11

Biological traits24

DNA specimens9

eDNA detections7

Sources11 archives

Databases and archives Stipa lessingiana's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 232 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF4 232 records

Environmental DNA1 datasets · 4 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Stipa lessingiana, called Lessing feather grass, is a species of flowering plant in the genus Stipa, found in steppes from Greece east to Mongolia, including the countries bordering the Black and Caspian Seas, Central Asia, western Siberia, the Altai, and Xinjiang in China. It has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.7 m

Plant height min0.3 m

Seed mass2.36 mg

Seed mass max4.45 mg

Seed mass min0.27 mg

Life cycle & reproduction5

Flowering endMay

Flowering startApr

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 300 m

Elevation mean1 050 m

Elevation min800 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: graminoid

Habitat GIFTmountains, steppe, stony places

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)826 mg/g

Specific leaf area (SLA)5.46 mm²/mg

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stipa lessingiana has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences10

eDNA detections7

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPQ443814.1 ↗345 bpKazakhstan · 2024

ACGT

CAATCGAATGAGGGGGTGAGGATGCATCTTTGCCCCAAACCCCCTCGTTGCCTAGGTGTGCTTGGCCTTTCCCCATTCGTTCTTGGCCGG …

Stipa lessingiana voucher WK24-1270 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL4★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Stipa lessingiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–442n range44median44mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 445×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.

CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.

CCDB · ipcn-api-dl — Strid, A. & I. A. Andersson. 1985. Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203–228.

CCDB · eflora

n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sheidai, M. & S. Attaei. 2005. Meiotic studies of some Stipa (Poaceae) species and populations in Iran. Cytologia 70: 23–31.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 232 records

Wild obs. + sensor2 638

Museum / vouchered1 543

Other51

Origin

Native2

Range

Area of Occupancy AOO7 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 1 237≤1 km 634≤10 km 67>10 km 142

2 080 georeferenced · 558 without coordinates

Open the mapobservation + sensor2 638

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 119≤1 km 627≤10 km 199>10 km 21

966 georeferenced · 577 without coordinates

Open the institutions mapphysical evidence1 543

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	397
BRNUlocation not on record	60
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	59
Wlocation not on record	16
Dresden, DE	6
Samara National Research Universitylocation not on record	6
MAlocation not on record	4
Kew, GB	4
LDlocation not on record	3
Herbarium of South China Botanical Gardenlocation not on record	3
València, ES	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Salamanca, ES	2
Logan, US	2
Berlin, DE	2
Xining, CN	2
Durham, US	2
Bronx, US	1
WNNUlocation not on record	1
Saint Louis, US	1
Wellington, NZ	1
Adam Mickiewicz University in Poznańlocation not on record	1
GJOlocation not on record	1
South Kensington, GB	1
Edinburgh, GB	1

25 institutions · 581 of 1 543 vouchered records shown · 959 without an institution code

09Environmental DNA7 detections

Where the DNA of Stipa lessingiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

Piedmont desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.3 °C 8.40–23.8

Seasonal swing summer↔winter29.1 °C

Max temp (day)19.8 °C 12.2–29.8

Min temp (night)10.2 °C 4.60–16.7

Precipitation50.0 mm/mo 37.4–54.7

Air humidity55.0 % 47.7–62.3

Moisture balance-73.4 mm/mo -130–-15.4

Vapour deficit945 Pa 496–1,548

Wind speed3.90 m/s 3.10–4.20

Cloud cover38.2 % 33.9–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stipa lessingiana

At a glance

Sources11 archives

Size & morphology5

Life cycle & reproduction5

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 232 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 232 records