Stigmina carpophila

(Lév.) M.B.Ellis · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Stigmina

At a glance

Occurrence records431

Data sources8

Biological traits0

DNA specimens0

eDNA detections34

Sources8 archives

Databases and archives Stigmina carpophila's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility431 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF431 records

Environmental DNA4 datasets · 5 countries34 detections

DNA & barcodingNCBIsequences

01Narrative

Stigmina carpophila (syn. Wilsonomyces carpophilus) is a fungal plant pathogen causing shot hole disease in stone fruits (Prunus spp.).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition2 compounds

Compounds documented for Stigmina carpophila across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

3-Spirotetramic acids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Pseurotin A4		present	LOTUS
Pseurotin A5		present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stigmina carpophila has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections34

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMN957562.1 ↗303 bp

ACGT

GAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACCTCTCGGTATTCCGGGAGGTATG …

Wilsonomyces carpophilus isolate OTU_567 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type431 records

Wild obs. + sensor342

Museum / vouchered79

Cultivated / captive1

Other9

Origin

Native1

Range

Area of Occupancy AOO1 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 207≤1 km 71≤10 km 17

295 georeferenced · 47 without coordinates

Open the mapobservation + sensor342

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤1 km 15≤10 km 4>10 km 9

28 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence79

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Academy of Sciences of the Republic of Uzbekistanlocation not on record	16
Auckland, NZ	7
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	7
WU-MYClocation not on record	6
Nurata nature reservelocation not on record	4
Helsinki, FI	4
McWane Science Centerlocation not on record	3
Kew, GB	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
Bronx, US	1
Görlitz, DE	1
Mlocation not on record	1
Olocation not on record	1
ILLSlocation not on record	1
Karlsruhe, DE	1
FAMCALlocation not on record	1
LDlocation not on record	1

17 institutions · 59 of 79 vouchered records shown · 20 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA34 detections

Where the DNA of Stigmina carpophila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys4

Countries5

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 11.2–24.4

Seasonal swing summer↔winter19.7 °C

Max temp (day)21.0 °C 15.2–29.6

Min temp (night)11.6 °C 6.60–19.1

Precipitation115 mm/mo 32.9–158

Air humidity58.0 % 51.5–60.6

Moisture balance-12.4 mm/mo -81.0–44.5

Vapour deficit773 Pa 550–1,538

Wind speed3.00 m/s 1.70–4.40

Cloud cover34.1 % 27.0–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)