Stigmella suberivora

(Stainton, 1869) Beirne, 1945 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nepticulidae/Stigmella

At a glance

Occurrence records460

Data sources8

Biological traits0

DNA specimens23

eDNA detections29

Sources8 archives

Databases and archives Stigmella suberivora's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility460 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF460 records

Environmental DNA1 datasets · 5 countries29 detections

DNA & barcodingBOLD23 specimens

01Narrative

Stigmella suberivora is a moth of the family Nepticulidae. It is widespread in the western Mediterranean region, where it is found in Portugal, Spain, southern France (along the Atlantic coast northwards to Brittany), Italy, Corsica, Sardinia, Sicily, the Adriatic coast in Slovenia, Croatia and Bosnia. It is also found in North Africa, including Algeria and Tunisia. It is an introduced and established species in southern England. Records of leafmines in Mallorca are probably also this species. The wingspan is 4.8-7.1 mm. Adults are on wing from April to October. The larvae feed on Quercus coccifera, Quercus ilex, Quercus ilex rotundifolia and Quercus suber. They mine the leaves of their host plant. The mine consists of an irregular, broad corridor. The frass is concentrated in a broad frass line that almost fills the gallery, leaving only a narrow transparent zone at either side. Pupation takes place outside of the mine.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stigmella suberivora has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes2

eDNA detections29

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

82Cmostly conserved

TTTATATTTTATATTTGGAATTTGATCTGGTATAGTAGGTACATCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCCGGTTCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes3

BIN1

Most divergent pair1.2%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stigmella ilicifoliellasame genus2.4%Stigmella cocciferaesame genus6.1%Stigmella zangheriisame genus6.6%Stigmella dentataesame genus6.7%Stigmella fumidasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PEF1-alpha

animal barcodemarker

08Occurrence & distribution

Record type460 records

Wild obs. + sensor357

Museum / vouchered103

Origin

Native1

Range

Area of Occupancy AOO808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 152≤1 km 69≤10 km 113>10 km 1

335 georeferenced · 22 without coordinates

Open the mapobservation + sensor357

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 1≤1 km 40≤10 km 2

43 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	93
Tartu, EE	3
European Distributed Institute of Taxonomy (EDIT)location not on record	1

3 institutions · 97 of 103 vouchered records shown · 6 without an institution code

09Environmental DNA29 detections

Where the DNA of Stigmella suberivora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map5 countries0

Chenaie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 13.1–19.9

Seasonal swing summer↔winter15.8 °C

Max temp (day)19.6 °C 16.7–23.2

Min temp (night)10.8 °C 8.60–17.5

Precipitation79.2 mm/mo 37.5–89.6

Air humidity58.6 % 56.5–61.9

Moisture balance-15.2 mm/mo

Vapour deficit765 Pa 684–1,026

Wind speed2.50 m/s

Cloud cover39.7 % 34.9–40.2

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)