Stifftia chrysantha

J.C.Mikan · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Stifftia

At a glance

Occurrence records377

Data sources12

Biological traits12

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Stifftia chrysantha's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility377 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF377 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 54

01Narrative

Stiffia chyrsantha is a species of flowering plant in the family Asteraceae, endemic to Brazil. It has a woody stem with rough bark, and can grow to 8-10 ft. It has alternate, entire smooth leaves and reticulate veins. The involucre has 30 to 40 green, imbricated scales with short hairs. Actinomorphic corollas are pale orange below and darker above. M. H. Mathias WP 20140706 13 13 11 Pro (14597012745).jpg Stifftia chrysantha.jpg

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology2

Plant height4 m

Plant height max4 m

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition4 compounds

Compounds documented for Stifftia chrysantha across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Stigmastane steroids1

Flavonols1

Flavones1

Flavanones1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Eriodictyol	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS
Quercetin	present	LOTUS
Sitogluside	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stifftia chrysantha has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSMN457834.1 ↗643 bp

ACGT

TCGAAACCTGCACAGCAGAACGACCCGCGAACATGTACCGACAGCCGGGCGTCGGGGGGAACGGGCGTCGGCCCGCGACCCCTGGCGCCC …

Stifftia chrysantha voucher TEX:Serra 235 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Stifftia chrysantha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 541×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gibbs, P. E. & R. Ingram. 1982. Chromosome numbers of some Brazilian flowering plants. Notes Roy. Bot. Gard. Edinburgh 40: 399–407.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type377 records

Wild obs. + sensor252

Museum / vouchered125

Origin

Native31

Range

Area of Occupancy AOO680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 142≤1 km 19≤10 km 16>10 km 6

183 georeferenced · 69 without coordinates

Open the mapobservation + sensor252

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFRRJlocation not on record	20
JBRJlocation not on record	19
Bronx, US	12
Istituto Agrario Castelnuovolocation not on record	9
Wlocation not on record	7
Maringá, BR	4
Seropédica, BR	4
St. Augustine, TT	3
Salvador, BR	3
PUC-RIOlocation not on record	3
UNESP-FCAlocation not on record	2
Stockholm, SE	2
UTFPR-CPlocation not on record	2
Blumenau, BR	2
Auckland, NZ	2
UEMlocation not on record	2
UFBAlocation not on record	2
Ivano-Frankivsk, UA	2
Christchurch, NZ	2
Kew, GB	1
Londrina, BR	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Criciúma, BR	1
Uberlândia, BR	1
UFSCarlocation not on record	1
Laboratorio de Ictiologialocation not on record	1
Santa Teresa, BR	1
UNESClocation not on record	1
CNF-UFHBlocation not on record	1
Durban, ZA	1
HUENFlocation not on record	1
BISHlocation not on record	1
Honolulu, US	1
UERJlocation not on record	1
Campo Mourão, BR	1
Museo naturalistico del Frignano Ferruccio Minghellilocation not on record	1
INMAlocation not on record	1
Chaguaramas, TT	1
Ural Federal University "B. N. Yeltsin"location not on record	1

40 institutions · 123 of 125 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Stifftia chrysantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)