Sticta canariensis

(Bory) Bory ex Delise · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Peltigerales/Lobariaceae/Sticta

At a glance

Occurrence records2 568

Data sources9

Biological traits0

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Sticta canariensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 568 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF2 568 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT · NCBI≈43 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition8 compounds

Compounds documented for Sticta canariensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Carotenoids (C40, β-β)8

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol	present	LOTUS
Antheraxanthin A	present	LOTUS
Astaxanthin	present	LOTUS
Auroxanthin	present	LOTUS
beta-Carotene	present	LOTUS
Cryptoxanthin	present	LOTUS
Phoenicoxanthin	present	LOTUS
Violaxanthin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sticta canariensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences5

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSDQ419944.1 ↗474 bpSpain

ACGT

CGAGAGAGGCGTCAGCCTCGGGGGCTTCGGCTCCTTCTTCACACCCTGTGGATACCGAACCGGTGTTGCTTTGGCGGCGCGTGGCCGCCG …

Sticta canariensis voucher SCH-X5-01 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sticta canariensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈43 439 209 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Sticta canariensis0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type2 568 records

Wild obs. + sensor2 404

Museum / vouchered164

Range

Area of Occupancy AOO3 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 599≤1 km 1 164≤10 km 489>10 km 27

2 279 georeferenced · 125 without coordinates

Open the mapobservation + sensor2 404

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 12≤1 km 3≤10 km 16

31 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence164

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	44
Durham, US	15
San Sebastián, ES	13
Madison, US	9
US	9
MeiseBGlocation not on record	8
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	7
Edinburgh, GB	6
Uppsala, SE	6
Mlocation not on record	5
Berlin, DE	4
ASUlocation not on record	4
University of Gdansklocation not on record	3
South Kensington, GB	3
McWane Science Centerlocation not on record	3
Philadelphia, US	2
Vitoria, ES	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Madrid, ES	1
MAlocation not on record	1
BDBClocation not on record	1
Kew, GB	1
Paris, FR	1
IPA/SPlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
University of Stellenboschlocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
TSBlocation not on record	1
PHlocation not on record	1
University of Hamburglocation not on record	1

30 institutions · 157 of 164 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Sticta canariensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sticta canariensis

At a glance

Sources9 archives

Compound class profile1 class

Documented compounds8 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 568 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 568 records