Stereopsis humphreyi

(Burt) Redhead & D.A.Reid · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Stereopsidales/Stereopsidaceae/Stereopsis

At a glance

Occurrence records43

Data sources6

Biological traits0

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Stereopsis humphreyi's data was compiled from.

GBIFGlobal Biodiversity Information Facility43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF43 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stereopsis humphreyi has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences9

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ613493.1 ↗637 bpChina · 2021

ACGT

GTAGGTGAACCTGCGGAAGGATCATTATTGAATTAAAGTTGAGGGTTGTGCTGGCTTCTAGGAGCATGTGCACGCTTTCTTCCTTATTTT …

Baisuzhenia humphreyi isolate Soil small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor17

Museum / vouchered26

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 3≤10 km 5>10 km 1

9 georeferenced · 8 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 3≤10 km 5

8 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	11
WTUlocation not on record	10
Bronx, US	1
Personal Herbarium of FunDis, Steve Nesslocation not on record	1
TENN-Flocation not on record	1
Private Collection of Autumn Anglinlocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1

7 institutions · 26 of 26 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Stereopsis humphreyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

With Sitka spruce

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.70 °C 4.70–10.8

Seasonal swing summer↔winter13.4 °C

Max temp (day)6.80 °C 6.80–12.5

Min temp (night)2.20 °C 2.20–9.40

Precipitation266 mm/mo 196–266

Air humidity72.3 % 65.7–72.3

Moisture balance241 mm/mo

Vapour deficit235 Pa 235–458

Wind speed2.60 m/s

Cloud cover48.9 % 47.6–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)