Stephanus serrator

(Fabricius, 1798) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Stephanidae/Stephanus

At a glance

Occurrence records778

Data sources7

Biological traits0

DNA specimens15

eDNA detections16

Sources7 archives

Databases and archives Stephanus serrator's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility778 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF778 records

Environmental DNA1 datasets · 5 countries16 detections

DNA & barcodingBOLD15 specimens

01Narrative

Stephanus serrator is a species of parasitic wasp in the family Stephanidae, the crown wasps. This species is native to much of Europe and is to be seen in the breeding season on recently dead timber or wood products. The larvae are parasitoids of the larvae of wood-boring beetles.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stephanus serrator has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.17%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

4Cmostly conserved

10Cmostly conserved

190Amostly conserved

349Gvariable

496Cmostly conserved

AACCTTATACTTCATTTTCGGATTATGGGCAGGAACTTTAGGATCTTCAATAAGACTAATTATTCGAATAGAATTAAGAATACCAGGATC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type778 records

Wild obs. + sensor742

Museum / vouchered36

Range

Area of Occupancy AOO2 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 220≤1 km 89≤10 km 202>10 km 22

533 georeferenced · 209 without coordinates

Open the mapobservation + sensor742

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤1 km 10≤10 km 18

28 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	26
Bonn, DE	3
ZSMlocation not on record	1
OSUClocation not on record	1
Provincia di Livornolocation not on record	1

5 institutions · 32 of 36 vouchered records shown · 4 without an institution code

09Environmental DNA16 detections

Where the DNA of Stephanus serrator was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map5 countries0

ChenaieChablis chenaieUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 15.0–21.5

Seasonal swing summer↔winter18.9 °C

Max temp (day)22.9 °C 19.2–26.3

Min temp (night)13.0 °C 9.10–16.0

Precipitation71.8 mm/mo 32.9–138

Air humidity57.6 % 54.5–60.9

Moisture balance-55.4 mm/mo -128–13.0

Vapour deficit911 Pa 696–1,145

Wind speed2.20 m/s 1.50–3.30

Cloud cover33.3 % 31.3–37.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)