Stenotus armerioides

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Stenotus

At a glance

Occurrence records512

Data sources9

Biological traits6

DNA specimens7

eDNA detections5

Sources9 archives

Databases and archives Stenotus armerioides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility512 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF512 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Aster armerioides là một loài thực vật có hoa trong họ Cúc. Loài này được (Nutt.) Kuntze mô tả khoa học đầu tiên năm 1891.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Plant height0.3 m

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stenotus armerioides has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences9

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG220057.1 ↗307 bpCanada · 1978

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Stenotus armerioides voucher CCDB-24795-C12 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Stenotus armerioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · eflora

CCDB · eflora

n 91×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — ANDERSON, L.C., D.W. KYHOS, T. MOSQUIN, A.M. POWEL~, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. IX Haplopappus and other Astereae. Amer. J. Bot. 61: 665-671.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type512 records

Wild obs. + sensor268

Museum / vouchered244

Origin

Native13

Range

Area of Occupancy AOO1 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 141≤1 km 22≤10 km 20>10 km 8

191 georeferenced · 77 without coordinates

Open the mapobservation + sensor268

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 17≤1 km 54≤10 km 37>10 km 4

112 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence244

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	62
Musee des Dinosaures d'Esperaza (Aude)location not on record	40
Flagstaff, US	17
Bronx, US	16
Denver, US	16
Chadron, US	13
Missoula, US	9
Phoenix, US	7
Grand Junction, US	6
Boise, US	4
Albuquerque, US	4
Durango, US	4
Lincoln, US	4
Provo, US	4
Logan, US	3
Riverside, US	3
Wuzhou, CN	3
San Luis Obispo, US	3
Bloomington, US	3
US	3
Rocky Mountain Biological Laboratorylocation not on record	2
Spearfish, US	2
Saint Louis, US	2
San Diego, US	2
ASUlocation not on record	2
Moscow, US	2
WTUlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Kew, GB	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Moscow State Universitylocation not on record	1
Pullman, US	1
EL PASO, US	1
Pittsburg, US	1

34 institutions · 244 of 244 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Stenotus armerioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

eroded, calcareous slopes and crests of hillseroding south-facing bankbark

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)