Stenocorus cinnamopterus

(Randall, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Stenocorus

At a glance

Occurrence records888

Data sources5

Biological traits0

DNA specimens15

eDNA detections15

Sources5 archives

Databases and archives Stenocorus cinnamopterus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility888 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF888 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Stenocorus cinnamopterus is a species of beetles in the family Cerambycidae. The species is brown with orange legs.Description

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stenocorus cinnamopterus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

22Gmostly conserved

25Gmostly conserved

316Gmostly conserved

319Cmostly conserved

340Cmostly conserved

370Cmostly conserved

518Gmostly conserved

586Amostly conserved

AACATTATATTTCATTTTTGGGGCGTGATCAGGGATAGTCGGAACTTCCTTAAGAATTTTAATTCGATCAGAACTTGGGAACCCGGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes6

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stenocorus obtusussame genus14.3%Polietes domitorsame order14.6%Stenocorus vittigersame genus14.6%Stenocorus schaumiisame genus14.7%Phyto melanocephalasame order14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type888 records

Wild obs. + sensor760

Museum / vouchered128

Range

Area of Occupancy AOO2 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 377≤1 km 123≤10 km 24>10 km 97

621 georeferenced · 139 without coordinates

Open the mapobservation + sensor760

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 4≤1 km 23≤10 km 29>10 km 6

62 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lexington, US	28
Montgomery, US	27
Wuzhou, CN	25
University Park, US	23
CUlocation not on record	11
Lubbock, US	5
MAJClocation not on record	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
College Station, US	1
University of Tennessee at Chattanoogalocation not on record	1
OSUClocation not on record	1
Champaign, US	1

12 institutions · 128 of 128 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Stenocorus cinnamopterus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 17.6–22.1

Seasonal swing summer↔winter22.6 °C

Max temp (day)23.4 °C 23.4–27.2

Min temp (night)13.2 °C 13.2–18.2

Precipitation94.3 mm/mo 94.3–137

Air humidity55.0 % 55.0–57.9

Moisture balance-63.1 mm/mo -63.1–-53.6

Vapour deficit905 Pa 905–1,119

Wind speed6.40 m/s 5.90–6.40

Cloud cover36.1 % 36.1–37.2

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)