Stenatherina panatela

(Jordan & Richardson, 1908) · species

image placeholder — illustration coming later

Animalia/Chordata/Atheriniformes/Atherinidae/Stenatherina

At a glance

Occurrence records444

Data sources7

Biological traits7

DNA specimens3

eDNA detections7

Sources7 archives

Databases and archives Stenatherina panatela's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility198 records↗

OBISOcean Biodiversity Information System246 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS444 records

Environmental DNA2 datasets · 2 countries7 detections

DNA & barcodingBOLD3 specimens

01Narrative

The panatela silverside (Hypoatherina panatela) is a species of reef-dwelling silverside from the subfamily Atherinomorinae which is found in the southwest Pacific Ocean. This species grows to 11 cm in total length and is of minor importance to commercial fisheries.Sasaki, D. & Kimura, S. (2014): Taxonomic review of the genus Hypoatherina Schultz 1948 (Atheriniformes: Atherinidae). Ichthyological Research, 61 (3): 207-241. This species is the only species in the genus Stenatherina, although some authorities place it in the genus Hypoatherina. This species was described by David Starr Jordan and Robert Earl Richardson as Atherina panatela with the type locality given as Calayan Island in the Philippines. The specific name is the Spanish word for a long, thin cigar and is presumed to be a reference to the elongated, slender body of this fish.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length11 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max20 m

Depth min1 m

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stenatherina panatela has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P578 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.23%

Haplotypes2

BIN1

Most divergent pair0.17%

Where individuals differ — all 2 variable positions, in barcode order

201Tvariable

357Gvariable

CTGAGCCAACCTGGCTCGCTCCTCGGAGACGACCAAATCTATAACGTCATCGTAACAGCACACGCCTTTGTAATAATTTTCTTTATAGTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hypoatherina tsurugaesame family12.1%Hypoatherina temminckiisame family12.6%Atherinomorus lacunosussame family12.6%Atherinomorus insularumsame family12.8%Hypoatherina golaniisame family12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type444 records

Wild obs. + sensor348

Museum / vouchered96

Origin

Native1

Range

Area of Occupancy AOO324 km²

Depth

0–200 m sunlit45

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2 m · max 45.7 m · 45 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 347 without coordinates

Open the mapobservation + sensor348

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 8≤1 km 3≤10 km 11>10 km 9

31 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	12
Fisheries Research Laboratory, Mie Universitylocation not on record	2
CSIRO Oceans and Atmospherelocation not on record	2
Chicago, US	2
UWFClocation not on record	1
CASlocation not on record	1
Toronto, CA	1
	1
Ann Arbor, US	1

9 institutions · 23 of 96 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Stenatherina panatela was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.4 °C 27.1–27.6

Seasonal swing summer↔winter2.90 °C

Max temp (day)28.3 °C 27.9–29.3

Min temp (night)26.4 °C 25.7–26.9

Precipitation67.7 mm/mo 6.30–165

Air humidity63.3 % 62.5–64.5

Vapour deficit1,336 Pa 1,289–1,364

Cloud cover32.2 % 24.2–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)