Stemphylium solani

G.F.Weber · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleosporaceae/Stemphylium

At a glance

Occurrence records55

Data sources8

Biological traits0

DNA specimens62

eDNA detections63

Sources8 archives

Databases and archives Stemphylium solani's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility55 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF55 records

Environmental DNA2 datasets · 5 countries63 detections

DNA & barcodingBOLD · NCBI62 specimens

01Narrative

Stemphylium solani is a plant pathogen fungus in the phylum Ascomycota. It is the causal pathogen for grey leaf spot in tomatoes and leaf blight in alliums and cotton, though a wide range of additional species can serve as hosts. Symptoms include white spots on leaves and stems that progress to sunken red or purple lesions and finally leaf necrosis. S. solani reproduces and spreads through the formation of conidia on conidiophores. The teleomorph name of Stemphyllium is Pleospora though there are no naturally known occurrences of sexual reproduction. Resistant varieties of tomato and cotton are common, though the pathogen remains an important disease in Chinese garlic cultivation.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stemphylium solani has left across the world's sequence archives.

At a glance

DNA specimens62

Marker genes2

GenBank sequences10

eDNA detections63

Countries7

The DNA barcodea real sequence read deposited for this species

ITSOP886753.1 ↗384 bpIran

ACGT

CATTTCGGTGAGGACTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGG …

Stemphylium solani strain A7 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type55 records

Museum / vouchered55

Range

Area of Occupancy AOO76 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 1≤10 km 7>10 km 3

11 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence55

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	9
Görlitz, DE	1
Université de Montréal Biodiversity Centrelocation not on record	1
Catholic University of Pekinglocation not on record	1

4 institutions · 12 of 55 vouchered records shown · 13 without an institution code

09Environmental DNA63 detections

Where the DNA of Stemphylium solani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found63

Studies independent surveys2

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 63 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 15.2–25.9

Seasonal swing summer↔winter0.9 °C

Max temp (day)30.4 °C 20.1–30.4

Min temp (night)22.0 °C 9.10–22.0

Precipitation309 mm/mo 79.6–309

Air humidity68.8 % 57.3–68.8

Moisture balance162 mm/mo -38.4–162

Vapour deficit1,043 Pa 953–1,043

Wind speed0.7 m/s 0.7–3.40

Cloud cover49.9 % 38.3–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)