Stemphylium sarciniforme

(Cavara) Wiltshire · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleosporaceae/Stemphylium

At a glance

Occurrence records164

Data sources9

Biological traits0

DNA specimens3

eDNA detections28

Sources9 archives

Databases and archives Stemphylium sarciniforme's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility164 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF164 records

Environmental DNA2 datasets · 3 countries28 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Stemphylium sarciniforme is a plant pathogen infecting lentil, red clover and chickpea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stemphylium sarciniforme has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections28

Countries4

The DNA barcodea real sequence read deposited for this species

ITSAY329221.1 ↗487 bpIran

ACGT

GCGGGCTGGGACCTCATCTCGGTGAGGACTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTT …

Stemphylium sarciniforme strain EGS29-188 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type164 records

Wild obs. + sensor12

Museum / vouchered130

Cultivated / captive1

Other21

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 3≤1 km 1≤10 km 8

12 georeferenced

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤1 km 4≤10 km 80>10 km 11

95 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence130

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	65
Bernard Price Institute for Palaeontological Researchlocation not on record	20
DPIlocation not on record	8
Catholic University of Pekinglocation not on record	7
Auckland, NZ	6
Bronx, US	4
Kew, GB	2
Madison, US	2
Hirosaki Universitylocation not on record	1
Tartu, EE	1

10 institutions · 116 of 130 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA28 detections

Where the DNA of Stemphylium sarciniforme was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 6.10–17.6

Seasonal swing summer↔winter22.7 °C

Max temp (day)14.5 °C 8.60–21.4

Min temp (night)8.40 °C 3.80–13.5

Precipitation78.3 mm/mo 63.3–87.5

Air humidity64.0 % 58.8–67.6

Moisture balance12.8 mm/mo -54.1–44.6

Vapour deficit479 Pa 306–802

Wind speed4.20 m/s 3.30–4.40

Cloud cover48.0 % 38.4–59.7

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)