Stellaria media
(L.) Vill. · speciesAt a glance
Occurrence records654 676
Data sources15
Biological traits79
DNA specimens88
eDNA detections51
Sources15 archives
Databases and archives Stellaria media's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility654 674 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics88 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources79 traits
Chemical compositionLOTUS · NPASS147 compounds
Occurrence & distributionGBIF · PBDB654 676 records
Environmental DNA1 datasets · 11 countries51 detections
DNA & barcodingBOLD · NCBI88 specimens
Genome at a glanceCCDB · GIFT · GoaT1.1 Gbp
Deep timePBDB2 fossils
01Narrative
La Stellaire intermédiaire, également appelée le Mouron blanc ou la Morgeline, est une espèce de plantes à fleurs de la famille des Caryophyllaceae. C'est une plante herbacée annuelle, bisannuelle ou vivace commune en Europe et dans une grande partie de l'hémisphère nord. Elle peut faire office de plante bioindicatrice car sa présence est la signature d'un sol équilibré et fertile.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology26
Fruit length5 mm
Fruit length max7 mm
Fruit length min3.5 mm
Fruit width3 mm
Leaf length15 mm
⚠ sources differ — AusTraits: 15 mm · GIFT: 20 mm
Leaf length max30 mm
Leaf length min5 mm
Leaf mass8.75 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 488 mm² · GIFT: 488 mm²
Leaf width10 mm
Leaf width max15 mm
Leaf width min2 mm
Plant height0.203 m
⚠ sources differ — GIFT: 0.203 m · AusTraits: 0.2 m · LEDA: 0.225 m · TRY: 0.373 m
Plant height generative0.23 m
Plant height max0.8 m
Plant height min0.01 m
Seed length1.09 mm
⚠ sources differ — TRY: 1.09 mm · AusTraits: 1.05 mm · GIFT: 1 mm
Seed length max1.1 mm
Seed length min1 mm
Seed mass0.353 mg
⚠ sources differ — TRY: 0.353 mg · LEDA: 0.382 mg · GIFT: 2.52 mg
Seed mass max0.6 mg
Seed mass min0 mg
Seed volume0.57 mm³
Seed volume max0.65 mm³
Seed volume min0.52 mm³
Seed width1 mm
Life cycle & reproduction21
Deciduousness3
⚠ sources differ — TRY: 3 · GIFT: evergreen
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flower colourwhite
Flower length max6 mm
Flower length min3 mm
Flowering endDec
Flowering startJan
Flowering timennnnnnnnynnn
Life formannual or biennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual · LEDA: perennials · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
⚠ sources differ — LEDA: Chamaephyte · GIFT: therophyte
Reproduction asexualabsent
Reproductive maturity0.288 years
Resprouting capacityfire_killed
Seed number11 000
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica, Campo de Altitude, Campo Limpo, Restinga
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapeovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio10.32 g/g
Leaf c425 mg/g
Leaf dry-matter content (LDMC)131 mg/g
⚠ sources differ — TRY: 131 mg/g · LEDA: 84 mg/g
Leaf n36.31 mg/g
Leaf p5.16 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)52.35 mm²/mg
⚠ sources differ — TRY: 52.35 mm²/mg · LEDA: 47 mm²/mg · GIFT: 53.68 mm²/mg
Wood density56.02 mg/cm³
Other traits5
Diaspore typeone-seeded generative dispersule
Seeds per fruit>1000
Shoot length max40 cm
Shoot length min10 cm
Shoot orientationascending
03Chemical composition147 compounds
Compounds documented for Stellaria media across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Aporphine alkaloids $ Isoquinoline alkaloids19
Aminoacids15
Kaurane and Phyllocladane diterpenoids10
Simple phenolic acids8
Cinnamic acid amides8
Documented compounds147 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Episyringaresinol | present | NPASS | |
| (+)-Syringaresinol | present | NPASS | |
| (+)-Valine | present | LOTUS | |
| (-)-Corydalmine | present | NPASS | |
| (-)-Kaur-16-en-19-oic acid | present | NPASS | |
| (-)-Nornuciferine | present | NPASS | |
| (1S)-1-[(4-hydroxy-3-methoxyphenyl)methyl]-6-methoxy-2-methyl-3,4-dihydro-1H-isoquinolin-7-ol | present | NPASS | |
| (1S,4R,9R,10R,13R,14R)-14-(hydroxymethyl)-5,5,9-trimethyl-tetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol | present | NPASS | |
| (1S,4R,9R,10R,13R,14S)-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol | present | NPASS | |
| (1S,4S,5R,9S,10R,13R,14R)-14-(acetyloxymethyl)-5,9-dimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid | present | NPASS |
05DNA & barcoding88 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stellaria media has left across the world's sequence archives.
At a glance
DNA specimens88
Marker genes7
GenBank sequences10
eDNA detections51
Countries12
The DNA barcodea real sequence read deposited for this species
CAAACAGAGACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAAACCCTGGAT …
Stellaria media voucher KS23 HER0284 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL7★rbcLa★ITS2★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Stellaria media carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 134 480 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Stellaria media1.13 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidy7× 7× · measured
Chromosome records18–442n range40median40mode103records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4037×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · brit-fl — Blackburn, K.B., Morton, J.K. New Phytol. 56: 344-351 (1957)
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · ipcn-api-dl — Morton, J. K. 1993. Chromosome numbers and polyploidy in the flora of Cameroon Mountain. Opera Bot. 121: 159–172.
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK, A. Jankun & E. Kuta. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 113–126.
CCDB · ipcn-api-dl — Nishikawa, T. 1985. Chromosome counts of flowering plants of Hokkaido (8). J. Hokkaido Univ. Educ., Sect. 2B 35: 97–111.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — Vachova, M. 1974a. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — Tani, K. 1981. Chromosomes of some species in Caryophyllaceae. Tokushima-ken Koto-gakko Rikagakkaishi. 22: 20–27.
CCDB · book-ipcn75-78 — 44
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · book-ipcn75-78 — Vachova 1974a
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-indian_vol1 — Rocen, T. 1927 ; Blackburn, K.B. (Peterson, D. 1936) ; Negodi, G. 1936b ; Mulligan, G.A. 1961a ; Hum- phries, C.J. et al. 1978
CCDB · book-indian_vol1 — Taylor, R.L. & Mulligan, G.A. 1968 ; Baquar, S.R. & Abid Askari, S.H. 1970a, b ; Scholte, G.A.M. 1978b; Tomkins, D.J. & Grant, W.F. 1978
CCDB · book-atlas-flowering-plants — Negodi 1935 (Fo)
CCDB · CromoCat 2015 — Blackburn, K. B. & Morton, J. K. (1957). The incidence of polyploidy in the Caryophyllaceae of Britain and of Portugal. New Phytol. 56(3): 344-351.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Morton, J. K. (1993). Chromosome numbers and polyploidy in the flora of Cameroon Mountain. Opera Bot. 121: 159-172.
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1967). Chromosome numbers of flowering plants in the Netherlands. III. Proc. Kon. Ned. Akad. Wetensch. Ser. C 70(1): 7-20.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1971b). Chromosome numbers of flowering plants in the Netherlands V. Proc. Kon. Ned. Akad. Wetensch. Ser. C 74: 335-343.
CCDB · CromoCat 2015 — Györffy, B. (1940). Chromosamenzählungen an kolchizininduzierten Polyploiden. Arbeiten Ung. Biol. Forschungsinst. 12: 326-329.
CCDB · CromoCat 2015 — Hindakova, M. (1974). Index of chromosome numbers of Slovakian flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1-23.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Mulligan, G. A. (1961). Chromosome numbers of Canadian weeds.III. Canad. J. Bot. 39(5): 1057-1066.
CCDB · CromoCat 2015 — Negodi, G. (1935). Reperti cariologici su Fanerogami. Atti Soc. Mat. Modena 67: 7-9.
CCDB · CromoCat 2015 — Negodi, G. (1936b). Contributo alla cariologia di Stellaria media (L.) Cir. Nuovo Giorn. Bot. Ital. 43(2): 416-424.
CCDB · CromoCat 2015 — Pogan, E. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov., Ser. Bot. 22: 129-153.
CCDB · CromoCat 2015 — Pogan, E., R. Czapik, A. Jankun & E. Kuta. (1982b). Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 91-126.
CCDB · CromoCat 2015 — Rocén, T. (1927). Zur Embryologie der Centrospermen. Diss. Univ. Uppsala. Uppsala, Appelbergs Boktryckeri Aktiebolag : 1-184. Dissertation Univ. Uppsala
2n 4424×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · iapt · CCDB · brit-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · brit-fl — Sinha, , Whitehead, New Phytol. 64: 343-345 (1965)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1902
CCDB · mediterranean
CCDB · ipcn-api-dl — Sidhu, M. & S. S. Bir. 1983. Karyological studies on weeds on cultivable lands in Punjab, India. Trop. Plant Sci. Res. 1: 1–13.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Slavĭk, B., V. Jarolĭmovă & J. Chrtek. 1993. Chromosome counts of some plants from Cyprus. Candollea 48(1): 221–230.
CCDB · ipcn-api-dl — Runemark, H. 1996. Mediterranean chromosome number reports 6 (590--678). Fl. Medit. 6: 223–243.
CCDB · ipcn-api-dl — Pogan, E. 1980. Further studies in chromosome numbers of Polish Angiosperms. Acta Biol. Cracov., Ser. Bot. 22: 129–153.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · book-indian_vol1 — Peterson, D. 1933 ; Tischler, G. 1934 ; Rohweder, H. 1937 ; Sinha, R.P. & Whitehead, F.H. 1965
CCDB · book-indian_vol1 — Bir, S.S. & Sidhu, M. 1980
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
CCDB · CromoCat 2015 — Blackburn, K. B. & Morton, J. K. (1957). The incidence of polyploidy in the Caryophyllaceae of Britain and of Portugal. New Phytol. 56(3): 344-351.
CCDB · CromoCat 2015 — Cauwet, A. M. (1968). Contribution a l'étude caryologique des Ombellifères de la partie orientale des Ptrénées. Naturalia Monspel., Sér. Bot. 19: 5-27.
CCDB · CromoCat 2015 — Petersson, D. (1933). Stellaria media L. X Stellaria neglecta Weih. Bot. Not. 1933: 500-504.
CCDB · CromoCat 2015 — Petersson, D. (1936). Stellaria-Studien zur Zytologie, Genetik, ökologie und Systematik der Gattung Stellaria,. insbesonden der media-gruppe. Bot. Not. 1936: 281-419.
CCDB · CromoCat 2015 — Rohweder, H. (1937). Versuch zur Erfassung der mengenmässigen Bedechung des Darss und Zingst mit polyploiden Pflanzen. Ein Beitrag zur Bedeutung der Polyploidie bei der Eroberung neuer Lebensräume. Planta 27(4): 501-549.
CCDB · CromoCat 2015 — Runemark, H. (1996). Mediterranean chromosome number reports-6 Fl. Medit. 6: 223-243.
CCDB · CromoCat 2015 — Sidhu, M. & S.S. Bir. (1983). Karyological studies on weeds on cultivable lands in Punjab, India. Trop. Plant Sci. Res. 1: 1-13.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
GIFT · GIFT (floras)
2n 4221×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Reports (204-216). Lara Ruz, J.Fl. Mediterranea3: 354-358(1993).
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · mediterranean
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Lara Ruiz, J. 1993. Mediterranean chromosome number reports 3 (204--216). Fl. Medit. 3: 354–358.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.
CCDB · book-northern-plants — Peterson 1936.
CCDB · book-indian_vol1 — Heiser, C.B. & Whitaker, T.W. 1948.; Love, A. & Love, D. 1956b
CCDB · kew — Bennett MD. 1972. Nuclear DNA content and minimum generation time in herbaceous plants. Proceedings of the Royal Society of London Series B-Biological Sciences. 181:109-135
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1967). Chromosome numbers of flowering plants in the Netherlands. III. Proc. Kon. Ned. Akad. Wetensch. Ser. C 70(1): 7-20.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1971b). Chromosome numbers of flowering plants in the Netherlands V. Proc. Kon. Ned. Akad. Wetensch. Ser. C 74: 335-343.
CCDB · CromoCat 2015 — Heiser, C. B. & Whitaker, T. W. (1948). Chromosome number, polyploidy and growth habit in California weeds. Amer. J. Bot. 35(3): 179-186.
CCDB · CromoCat 2015 — Lara Ruíz, J. (1993). Reports (204-216). Fl. Medit. 3: 354-358.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1956b). Cytotaxonomical conspectus of the Icelandic flora. Acta Horti Gothob. 20(4): 65-291.
CCDB · CromoCat 2015 — Petersson, D. (1936). Stellaria-Studien zur Zytologie, Genetik, ökologie und Systematik der Gattung Stellaria,. insbesonden der media-gruppe. Bot. Not. 1936: 281-419.
CCDB · CromoCat 2015 — Pogan, E. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov., Ser. Bot. 22: 129-153.
CCDB · CromoCat 2015 — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya (1996). Chromosome numbers in synanthropic plants fromt he Russian Far East. Bot. Zhurn. 81(5): 98-101
2n 229×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · iber-fl +5
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Blackburn, K.B., Morton, J.K. New Phytol. 56: 344-351 (1957)
CCDB · iber-fl — The incidence of polyploidy in the Caryophyllaceae of Britain and of Portugal. Blackburn, K. B. & J. K. Morton.New Phytol.56: 344-351(1957).
CCDB · mediterranean
CCDB · ipcn-api-dl — Runemark, H. 1996. Mediterranean chromosome number reports 6 (590--678). Fl. Medit. 6: 223–243.
CCDB · book-fedorov — Peterson 1935, 1936
CCDB · book-fedorov — Blackburn, Morton 1957 m
CCDB · book-atlas-flowering-plants — Peterson 1936
CCDB · Cave1957 — Blackburn & Morton
2n 284×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants · CCDB · CromoCat 2015 +1
CCDB · book-indian_vol1 — Pal, N. 1952
CCDB · book-atlas-flowering-plants — Pal 1952 (Fo)
CCDB · CromoCat 2015 — Pal, N. (1952). A contribution to the life-histories of Stellaria media L. and Polycarpon loeflingiae Benth. et Hook. Proc. Natl. Inst. Sci. India 18(5): 363-378.
GIFT · GIFT (floras)
2n 182×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · CromoCat 2015 — Krasnikov, A. A. & Schaulo, D. N. (1990). Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II Botani?eskij Žurnal (Moscow & Leningrad) 75: 118-120
2n 202×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-fedorov — Negodi 1936c
CCDB · book-atlas-flowering-plants — Negodi 1935
2n 362×CCDB · CromoCat 2015 · GIFT · GIFT (floras)
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
GIFT · GIFT (floras)
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789
2n 241×CCDB · iber-fl
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. III. Caryophyllaceae Fernandes, A. & M. T. Leitao.Bol. Soc. Brot. ser. 245: 143-176(1971).
2n 261×CCDB · iapt
CCDB · iapt
n 208×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · CromoCat 2015 — Baquar, S. R. & Abid Askari, S. H. (1970a). Chromosome numbers in some flowering plants of West Pakistan. Genét. Ibér. 22: 1-11.
CCDB · CromoCat 2015 — Baquar, S. R. & Abid Askari, S. H. (1970b). Chromosome studies in some flowering plants of West Pakistan. II. Genét. Ibér. 22: 41-51.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
n 228×CCDB · mediterranean · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +1
CCDB · mediterranean
CCDB · book-ipcn65 — Sinha & W. 1965
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — Çelebio|3glu, T. & C. Favarger. 1993. Mediterranean chromosome number reports 3 (125--166). Fl. Medit. 3: 323–333.
CCDB · CromoCat 2015 — Çelebioglu, T. & Favarger, C. (1993). Rapports (125-166). Fl. Medit. 3: 323-333.
CCDB · CromoCat 2015 — Hill, L. M. (1989). IOPB Chromosome Data 1 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 13: 17-19.
n 03×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Morton, J. K. (1993). Chromosome numbers and polyploidy in the flora of Cameroon Mountain. Opera Bot. 121: 159-172.
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
n 132×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
7×1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
07Deep time11.6–2.58 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range11.6–2.58 Ma Miocene, Pliocene
Dated fossil finds2
StatusNot recorded since 2.58 Ma
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Stellaria media. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type654 676 records
Wild obs. + sensor615 199
Museum / vouchered37 322
Cultivated / captive534
Fossil3
Other1 618
Origin
Native42 138
Introduced7 197
Range
Area of Occupancy AOO758 592 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy45% within 1 km
≤100 m 111 181≤1 km 133 667≤10 km 294 974>10 km 5 914
545 736 georeferenced · 69 463 without coordinates
Open the mapobservation + sensor615 199
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 2 296≤1 km 9 729≤10 km 14 746>10 km 1 253
28 024 georeferenced · 9 298 without coordinates
Open the institutions mapphysical evidence37 322
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 18>10 km 13
31 georeferenced · 503 without coordinates
Open the mapnot free-living534
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions312 of 570 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 19 747 |
| BIO-UNIPIlocation not on record | 622 |
| BFLlocation not on record | 606 |
| Helsinki, FI | 585 |
| Berlin, DE | 478 |
| LDlocation not on record | 398 |
| DBF-NHMDlocation not on record | 339 |
| South Kensington, GB | 328 |
| Moscow State Universitylocation not on record | 313 |
| Philadelphia, US | 266 |
| BRNUlocation not on record | 261 |
| Salzburg, AT | 256 |
| Chongqing Museumlocation not on record | 253 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 217 |
| Odawara, JP | 200 |
| Beijing, CN | 190 |
| Uniwersytet Warszawskilocation not on record | 184 |
| Uniwersytet Śląski w Katowicachlocation not on record | 178 |
| MeiseBGlocation not on record | 175 |
| Riverside, US | 174 |
| Olocation not on record | 165 |
| Museo Entomologico de Leonlocation not on record | 159 |
| Wuzhou, CN | 149 |
| Claremont, US | 145 |
| Adam Mickiewicz University in Poznańlocation not on record | 141 |
| Nagano City, JP | 133 |
| WTUlocation not on record | 133 |
| Oskarshamn, SE | 130 |
| San Diego, US | 124 |
| Bergen, NO | 121 |
| Trondheim, NO | 121 |
| València, ES | 115 |
| Canberra, AU | 114 |
| Bloomington, US | 112 |
| Fort Worth, US | 110 |
| Chengdu, CN | 109 |
| Adelaide, AU | 106 |
| MAlocation not on record | 106 |
| Saint Louis, US | 105 |
| SLU Artdatabankenlocation not on record | 104 |
| Québec, CA | 102 |
| Santa Barbara, US | 102 |
| CICYTEXlocation not on record | 100 |
| Provincia di Livornolocation not on record | 98 |
| Pullman, US | 95 |
| Mount Annan, AU | 92 |
| Shinshu Universitylocation not on record | 88 |
| Oulu, FI | 86 |
| Bronx, US | 85 |
| Turku, FI | 84 |
| Görlitz, DE | 84 |
| Kochi, JP | 84 |
| Brisbane, AU | 82 |
| TROMlocation not on record | 79 |
| Tartu, EE | 77 |
| St. Paul, US | 75 |
| Madison, US | 70 |
| Chiba, JP | 69 |
| Sanda, JP | 66 |
| Austin, US | 65 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 65 |
| Hobart, AU | 62 |
| Davis, US | 62 |
| BClocation not on record | 62 |
| University of Stellenboschlocation not on record | 61 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 61 |
| Entomological Society of Latvialocation not on record | 61 |
| Wlocation not on record | 60 |
| Jyväskylä, FI | 58 |
| Williamsburg, US | 57 |
| College Park, US | 56 |
| Garðabær, IS | 55 |
| Bozeman, US | 55 |
| Durham, US | 54 |
| GMBAlocation not on record | 54 |
| Université Lavallocation not on record | 53 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 52 |
| Ann Arbor, US | 52 |
| Acadia Universitylocation not on record | 52 |
| CASlocation not on record | 51 |
| Toyama, JP | 51 |
| Kunming, CN | 51 |
| Taipei, TW | 51 |
| NSMKlocation not on record | 51 |
| KMNlocation not on record | 50 |
| Chapel Hill, US | 49 |
| College of the Atlantic, Museumlocation not on record | 49 |
| Corvallis, US | 49 |
| San Sebastián, ES | 49 |
| Arcata, US | 47 |
| Yangling, CN | 45 |
| San Luis Obispo, US | 45 |
| Bangkok, TH | 44 |
| Nanjing, CN | 43 |
| BAYLUlocation not on record | 43 |
| Moscow, US | 43 |
| GJOlocation not on record | 42 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 41 |
| Vancouver, CA | 41 |
| Uppsala, SE | 41 |
| National Institute of Biological Resourceslocation not on record | 39 |
| Mexico City, MX | 39 |
| Fukushima Universitylocation not on record | 38 |
| ASUlocation not on record | 37 |
| Wellington, NZ | 37 |
| Bando, JP | 37 |
| Canadian Department of Agriculturelocation not on record | 37 |
| Karlsruhe, DE | 36 |
| Pretoria, ZA | 36 |
| Barcelona, ES | 36 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 36 |
| UGentlocation not on record | 36 |
| Burlington, US | 35 |
| Kuopio, FI | 35 |
| Tampa, US | 34 |
| KURAlocation not on record | 33 |
| Uniwersytet Jagiellońskilocation not on record | 33 |
| Tomioka, JP | 32 |
| Salamanca, ES | 32 |
| Durango, MX | 32 |
| Pittsburg, US | 30 |
| Guangzhou, CN | 30 |
| Vitoria, ES | 29 |
| Paris, FR | 29 |
| Kensington, AU | 29 |
| BDBClocation not on record | 28 |
| Allentown, US | 28 |
| Norfolk, US | 28 |
| New Haven, US | 28 |
| Blumenau, BR | 28 |
| Chengdu, CN | 27 |
| Mlocation not on record | 27 |
| Green Bay, US | 26 |
| US | 26 |
| Taipei, TW | 25 |
| Tuscaloosa, US | 25 |
| Jackson, US | 25 |
| Obihiro Centennial City Museumlocation not on record | 25 |
| Tsukuba, JP | 25 |
| Chadron, US | 24 |
| WINlocation not on record | 24 |
| Granada, ES | 24 |
| Auckland, NZ | 24 |
| Irvine, US | 24 |
| Victoria, CA | 24 |
| Flagstaff, US | 24 |
| Christchurch, NZ | 24 |
| Tokushima, JP | 23 |
| Madrid, ES | 23 |
| Pamplona, ES | 23 |
| Missoula, US | 23 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 23 |
| Badajoz, ES | 22 |
| Tallinn, EE | 22 |
| Otaru, JP | 22 |
| Saint John, CA | 21 |
| US | 21 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 21 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 21 |
| GAlocation not on record | 20 |
| Kandalaksha State Nature Reservelocation not on record | 20 |
| UChlocation not on record | 20 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 20 |
| Wuhan, CN | 20 |
| Mexico City, MX | 19 |
| Emporia, US | 19 |
| Durban, ZA | 19 |
| Columbia, US | 19 |
| Toronto, CA | 18 |
| Armidale, AU | 18 |
| Guilin, CN | 18 |
| TAIElocation not on record | 18 |
| Denver, US | 18 |
| Portland, US | 17 |
| Porvoo, FI | 17 |
| CJBGlocation not on record | 17 |
| Nanjing, CN | 17 |
| EL PASO, US | 17 |
| Phyletisches Museum Jenalocation not on record | 16 |
| Millersville, US | 16 |
| Fayetteville, US | 16 |
| KR | 16 |
| Santa Cruz, US | 16 |
| Dekalb, US | 16 |
| Provo, US | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 16 |
| Severin-McDaniel Insect Collectionlocation not on record | 15 |
| Angwin, US | 15 |
| PrivatHerblocation not on record | 15 |
| Fredericton Stock Culture Collectionlocation not on record | 15 |
| Jaén, ES | 15 |
| Siouxland Heritage Museumlocation not on record | 15 |
| Long Beach, US | 14 |
| Richmond, US | 14 |
| Sagamihara, JP | 14 |
| Turlock, US | 14 |
| Xining, CN | 13 |
| Montréal, CA | 13 |
| Cape Town, ZA | 13 |
| Boise, US | 13 |
| McWane Science Centerlocation not on record | 13 |
| KIWElocation not on record | 13 |
| Phoenix, US | 13 |
| Taipei, TW | 13 |
| TUR-Alocation not on record | 13 |
| Kew, GB | 13 |
| JP | 13 |
| PRClocation not on record | 12 |
| Uniwersytet Opolskilocation not on record | 12 |
| Central China Normal Universitylocation not on record | 12 |
| Sevilla, ES | 12 |
| Mississippi State, US | 12 |
| Rotorua, NZ | 12 |
| Miami, US | 12 |
| Frankfurt am Main | 12 |
| Anchorage, US | 12 |
| Hiratsuka City Museumlocation not on record | 12 |
| GB | 12 |
| Sendai, JP | 12 |
| Rovaniemi, FI | 12 |
| Nishihara, JP | 12 |
| Institute of the biological problems of the North FEB RASlocation not on record | 12 |
| Porrentruy, CH | 12 |
| Whitewater, US | 11 |
| Jena Microbial Resource Collectionlocation not on record | 11 |
| UIBlocation not on record | 11 |
| 11 | |
| Alicante, ES | 11 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 11 |
| Dover, US | 10 |
| San Francisco, US | 10 |
| UniKSlocation not on record | 10 |
| DMZ botanic gardenlocation not on record | 10 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 10 |
| KIRMlocation not on record | 10 |
| Wuhan, CN | 10 |
| Los Angeles, US | 10 |
| Osaka, JP | 10 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 9 |
| Texas Lutheran Universitylocation not on record | 9 |
| Kushiro City Museumlocation not on record | 9 |
| Fairfax, US | 9 |
| Ciudad de México, MX | 9 |
| Logan, US | 9 |
| Xinxiang, CN | 9 |
| Changsha, CN | 9 |
| Ischia Marine Centrelocation not on record | 9 |
| Stephenville, US | 9 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 9 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 9 |
| Staten Island, US | 9 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 9 |
| Zhengzhou, CN | 9 |
| Valdosta State Universitylocation not on record | 8 |
| Lubbock, US | 8 |
| AASlocation not on record | 8 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 8 |
| Tacoma, US | 8 |
| Awka, NG | 8 |
| Albuquerque, US | 8 |
| Nagatoro-machi, Chichibu-gun, JP | 8 |
| Knoxville, US | 8 |
| Korea National Arboretumlocation not on record | 7 |
| Little Rock, US | 7 |
| Cheney, US | 7 |
| Palmerston, AU | 7 |
| DOI/NPS, Greenbelt Parklocation not on record | 7 |
| University of Alberta Museumslocation not on record | 7 |
| Denton, US | 7 |
| Universidade Federal de Pelotaslocation not on record | 7 |
| Harrisonburg, US | 7 |
| BSBIlocation not on record | 7 |
| Museo Achille Folettolocation not on record | 7 |
| Zürich, CH | 7 |
| Guiyang, CN | 7 |
| Zürich, CH | 7 |
| Valparaiso, CL | 7 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 7 |
| Beijing Normal Universitylocation not on record | 7 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 7 |
| Spearfish, US | 7 |
| Universidad de Caldas (UCaldas)location not on record | 7 |
| Universidad de Antioquia (UdeA)location not on record | 7 |
| Edmonton, CA | 7 |
| Urumqi, CN | 7 |
| University of Tennessee at Chattanoogalocation not on record | 6 |
| Lord Fairfax Community Collegelocation not on record | 6 |
| Clemson, US | 6 |
| Nunoa, Santiago, CL | 6 |
| Edinburgh, GB | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| University of Southern Mississippilocation not on record | 6 |
| Iwate Prefectural Museumlocation not on record | 6 |
| J.F.Oberlin Universitylocation not on record | 6 |
| IDElocation not on record | 6 |
| San Angelo, US | 6 |
| Johnson City, US | 6 |
| Pocatello, US | 5 |
| Nishihara, JP | 5 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 5 |
| Anhui Normal Universitylocation not on record | 5 |
| BISHlocation not on record | 5 |
| Henderson, US | 5 |
| AUAlocation not on record | 5 |
| Seoul, KR | 5 |
| FUVATESlocation not on record | 5 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 5 |
| Chicago, US | 5 |
| Davenport, US | 5 |
| Honolulu, US | 5 |
| Ishikawa Museum of Natural Historylocation not on record | 5 |
| Northridge, US | 5 |
| QVMAGlocation not on record | 5 |
| Guangzhou, CN | 5 |
| Palmerston North, NZ | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Puerto Ayora, EC | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 5 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 4 |
| Frauenfeld, CH | 4 |
| Lincoln, US | 4 |
| QAUlocation not on record | 4 |
| Smithfield, AU | 4 |
| Ashland, US | 4 |
| Córdoba, ES | 4 |
| Portland, US | 4 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 4 |
| University of New Hampshirelocation not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Corrientes, AR | 4 |
| BGPAlocation not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Smithsonian Institutionlocation not on record | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| NMBU:MINAlocation not on record | 4 |
| AADClocation not on record | 4 |
| Omachi Alpine Museumlocation not on record | 4 |
| Kagoshima, JP | 4 |
| Philadelphia, US | 4 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 4 |
| IWEP FEB RASlocation not on record | 4 |
| Chongqing Natural History Museumlocation not on record | 4 |
| Lanzhou, CN | 4 |
| Jefferson City, US | 4 |
| JGSlocation not on record | 4 |
| Anchorage, US | 4 |
| Keene State Universitylocation not on record | 4 |
| Forssa, FI | 4 |
| KOMlocation not on record | 3 |
| Hangzhou, CN | 3 |
| New Brunswick, US | 3 |
| Monastir, TN | 3 |
| DASSHlocation not on record | 3 |
| UFSMlocation not on record | 3 |
| Laboratorio de Ictiologialocation not on record | 3 |
| Walla Walla, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Bourges, FR | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| Washington, US | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Cochabamba, BO | 3 |
| Strecker Museum, Baylor Universitylocation not on record | 3 |
| Tianjin Natural History Museumlocation not on record | 3 |
| nbflocation not on record | 3 |
| DNSMlocation not on record | 3 |
| China Agricultural Universitylocation not on record | 3 |
| Inner Mongolia Universitylocation not on record | 3 |
| Shenzhen, CN | 3 |
| GZUlocation not on record | 3 |
| Batemans Bay, AU | 3 |
| Beijing, CN | 3 |
| Xiamen, CN | 3 |
| Banyoles, ES | 3 |
| Northeastern Forestry Universitylocation not on record | 3 |
| Conway, US | 3 |
| Cascavel, BR | 3 |
| Durango, US | 3 |
| Fulda, DE | 3 |
| Montecillo, Texcoco, MX | 3 |
| SXTCMlocation not on record | 3 |
| Pamplona, ES | 3 |
| Feira de Santana, BR | 3 |
| PUC-RSlocation not on record | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 3 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 3 |
| KNAMlocation not on record | 3 |
| Parthenon Tama History Museumlocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Oswego, US | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| Austin, US | 2 |
| Göteborg, SE | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Podgorica, ME | 2 |
| Stockholm, SE | 2 |
| Western Carolina Universitylocation not on record | 2 |
| Bern, CH | 2 |
| Herb. BBGlocation not on record | 2 |
| Campo Mourão, BR | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| Chicago, US | 2 |
| Chicago, US | 2 |
| Jiujiang Forestry Institutelocation not on record | 2 |
| Cambridge, US | 2 |
| US | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| Brookings, US | 2 |
| Puebla, MX | 2 |
| Namur, BE | 2 |
| Kyoto Universitylocation not on record | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| Memorial University of Newfoundlandlocation not on record | 2 |
| Shanghai, CN | 2 |
| Kirksville, US | 2 |
| UoB-IBlocation not on record | 2 |
| Kathmandu, NP | 2 |
| JBSlocation not on record | 2 |
| La Paz, BO | 2 |
| Caldwell, US | 2 |
| Tula State Universitylocation not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Glocation not on record | 2 |
| Springfield, US | 2 |
| MEXUlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Chapingo, MX | 2 |
| Juriquilla, MX | 2 |
| Aarhus, DK | 2 |
| Conway, US | 2 |
| Chinese Academy of Forestrylocation not on record | 2 |
| Cambridge, US | 2 |
| NSW Office of Environment and Heritagelocation not on record | 2 |
| Joondalup, AU | 2 |
| LINUlocation not on record | 2 |
| SZUlocation not on record | 2 |
| H-Schuhwlocation not on record | 2 |
| Xian, CN | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Jishou Universitylocation not on record | 2 |
| Sion, CH | 2 |
| UFPRlocation not on record | 2 |
| TAFORI-LSRClocation not on record | 2 |
| Catalina Island Conservancylocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 2 |
| Loja, EC | 2 |
| UTFPR-CPlocation not on record | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Minia, EG | 1 |
| HUFDlocation not on record | 1 |
| Asheville, US | 1 |
| FFPRIlocation not on record | 1 |
| Yaoundé, CM | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Fredericksburg, US | 1 |
| Bogotá, D.C., CO | 1 |
| UFSClocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Chaguaramas, TT | 1 |
| University of Wisconsinlocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Guatemala City, GT | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| OLAlocation not on record | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| Brock University (BU)location not on record | 1 |
| SIHUlocation not on record | 1 |
| Due West, US | 1 |
| BioFokuslocation not on record | 1 |
| Criciúma, BR | 1 |
| Llocation not on record | 1 |
| Dresden, DE | 1 |
| Mount Pleasant, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Cusco, PE | 1 |
| US | 1 |
| Plocation not on record | 1 |
| Parkville, AU | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Sucre, BO | 1 |
| UNICAMPlocation not on record | 1 |
| San Isidro, AR | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Whitehorse, CA | 1 |
| Muzaffarabad, PK | 1 |
| ISAlocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Mérida, MX | 1 |
| Morelia, MX | 1 |
| Tempe, US | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Fullerton, US | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| San Francisco, US | 1 |
| Wollongong, AU | 1 |
| Ciudad de México, MX | 1 |
| Sant Julià de Lòria, AD | 1 |
| Kingston, US | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| WAGlocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Hudson, US | 1 |
| Philadelphia, US | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Firenze, IT | 1 |
| Gijón, ES | 1 |
| SJNAlocation not on record | 1 |
| Guasave, MX | 1 |
| Coimbra, PT | 1 |
| Sapporo, JP | 1 |
| Glarus, CH | 1 |
| La Paz, MX | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Tromso University Museumlocation not on record | 1 |
| 武陵山动植物研究所location not on record | 1 |
| AZE014location not on record | 1 |
| Rishon Le Zion, IL | 1 |
| UnBlocation not on record | 1 |
| LfUlocation not on record | 1 |
| UNESClocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Hamilton, US | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| The Cattle Museumlocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Dhaka, BD | 1 |
| Chongqing, CN | 1 |
| Instituto do Meio Ambientelocation not on record | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| Macomb, US | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Zapopan, MX | 1 |
| Lake Charles, US | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Ensenada, MX | 1 |
| Mohonk Preservelocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| Bend, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Grand Junction, US | 1 |
| Mexico City, MX | 1 |
| MSB-3054location not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| Cincinnati, US | 1 |
| Qufu Normal Universitylocation not on record | 1 |
570 institutions · 35 862 of 37 322 vouchered records shown · 1 058 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA51 detections
Where the DNA of Stellaria media was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found51
Studies independent surveys1
Countries11
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 51 detections have coordinates
Open the map11 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.0 °C 9.40–17.2
Seasonal swing summer↔winter19.7 °C
Max temp (day)18.6 °C 11.4–20.8
Min temp (night)9.30 °C 5.20–13.4
Precipitation77.6 mm/mo 56.3–95.8
Air humidity58.3 % 53.6–63.9
Moisture balance-20.6 mm/mo -50.1–16.9
Vapour deficit669 Pa 426–804
Wind speed3.40 m/s 2.40–4.50
Cloud cover44.0 % 34.7–53.4
CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.