Stellaria longifolia
(Regel) Muhl. ex Willd. · speciesAt a glance
Occurrence records25 579
Data sources8
Biological traits113
DNA specimens35
eDNA detections16
Sources8 archives
Databases and archives Stellaria longifolia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility25 579 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics35 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources113 traits
Occurrence & distributionGBIF25 579 records
Environmental DNA1 datasets · 4 countries16 detections
DNA & barcodingBOLD · NCBI35 specimens
Genome at a glanceCCDB2n = 26
01Narrative
Gwiazdnica długolistna – gatunek rośliny należący do rodziny goździkowatych (Caryophyllaceae).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology11
Leaf length25 mm
Leaf length max35 mm
Leaf length min15 mm
Leaf width max2 mm
Leaf width min0.5 mm
Plant height0.27 m
⚠ sources differ — GIFT: 0.27 m · LEDA: 0.15 m · USDA: 0.457 m · TRY: 0.212 m
Plant height generative0.175 m
Plant height max0.3 m
Plant height min0.1 m
Seed length0.7 mm
Seed mass0.121 mg
⚠ sources differ — TRY: 0.121 mg · LEDA: 0.086 mg · GIFT: 0.217 mg
Life cycle & reproduction33
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: anemochorous
Flower colourgreen
Flower conspicuousNo
Flowering endAug
Flowering startJul
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryModerate
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed number6 328
Seed spread rateSlow
Seedling vigorLow
Self fertilizationpresent
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment28
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 850 m
Elevation mean1 850 m
Elevation min1 850 m
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Growth formherb
Growth form USDASingle Crown
Habitat GIFTforest
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min8 in
Shape and orientationDecumbent
Small grainNo
Woodinessnon-woody
Physiology & chemistry20
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementLow
Fire resistantNo
Fire toleranceMedium
Frost free days min90 days
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min14 in
Protein potentialLow
Salinity toleranceNone
Shade toleranceLow
Soil pH max6.5 pH
Soil pH min4 pH
Temperature min-38 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound1 300 000 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeseed
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max11 000 per acre
Planting density min4 800 per acre
05DNA & barcoding35 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stellaria longifolia has left across the world's sequence archives.
At a glance
DNA specimens35
Marker genes9
GenBank sequences10
eDNA detections16
Countries5
The DNA barcodea real sequence read deposited for this species
GGATCATTGTCGAAACCTGCCCAGCAGAACGACCAGCGAACACGTTTAACTATATCGAGCGTCGGGAATATGCGGGCAGCCATGTGCTCC …
Stellaria longifolia voucher KHB1260050 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★ITS4★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Stellaria longifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidydiploid inferred
Chromosome records26–1042n range26median26mode12records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2611×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · eflora
CCDB · iapt
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.
CCDB · ipcn-api-dl — Morton, J. K. & R. K. Rabeler. 1989. Biosystematic studies on the Stellaria calyeantha (Caryophyllaceae). I. Cytology and cytogeography. Canad. J. Bot. 67: 121–127.
CCDB · ipcn-api-dl — MacDonald, S. E. & C. C. Chinnappa. 1988. Patterns of variation in the Stellaria longipes complex: effects of polyploidy and natural selection. Amer. J. Bot. 75: 1191–1200.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of vascular plants from nature reserves of the Primorsky Territory and the Amur River basin. Bot. Žhurn. (Moscow & Leningrad) 91(7): 1117–1134.
CCDB · eflora
CCDB · iapt — IAPT/IOPB Chromosome Data 20
CCDB · iapt — IAPT/IOPB Chromosome Data 26
2n 1041×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1977. Chromosome numbers of some plant species from the south of Siberia. II. Bot. Žhurn. (Moscow & Leningrad) 62(7): 1034–1042.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type25 579 records
Wild obs. + sensor18 247
Museum / vouchered7 322
Other10
Origin
Native4
Range
Area of Occupancy AOO69 824 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 6 816≤1 km 7 380≤10 km 2 602>10 km 556
17 354 georeferenced · 893 without coordinates
Open the mapobservation + sensor18 247
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 478≤1 km 1 698≤10 km 1 777>10 km 976
4 929 georeferenced · 2 393 without coordinates
Open the institutions mapphysical evidence7 322
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions132 of 222 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 815 |
| Olocation not on record | 795 |
| Moscow State Universitylocation not on record | 395 |
| LDlocation not on record | 372 |
| St. Paul, US | 290 |
| Philadelphia, US | 273 |
| Trondheim, NO | 230 |
| Chongqing Museumlocation not on record | 225 |
| Oulu, FI | 222 |
| Uniwersytet Wrocławskilocation not on record | 217 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 136 |
| BRNUlocation not on record | 133 |
| Madison, US | 133 |
| Turku, FI | 132 |
| Tartu, EE | 103 |
| SLU Artdatabankenlocation not on record | 101 |
| WINlocation not on record | 99 |
| Oskarshamn, SE | 96 |
| Bronx, US | 89 |
| Bloomington, US | 76 |
| TROMlocation not on record | 73 |
| Uppsala, SE | 70 |
| BFLlocation not on record | 70 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 69 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 66 |
| Ann Arbor, US | 64 |
| Bergen, NO | 61 |
| Uniwersytet Śląski w Katowicachlocation not on record | 60 |
| Vancouver, CA | 51 |
| Wuzhou, CN | 51 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 50 |
| Allentown, US | 49 |
| University of Alberta Museumslocation not on record | 47 |
| Université Lavallocation not on record | 45 |
| Jyväskylä, FI | 44 |
| Missoula, US | 43 |
| Victoria, CA | 43 |
| Görlitz, DE | 40 |
| Québec, CA | 39 |
| Kuopio, FI | 38 |
| New Haven, US | 36 |
| Moscow, US | 36 |
| WTUlocation not on record | 35 |
| University of Stellenboschlocation not on record | 32 |
| Philadelphia, US | 31 |
| Durham, US | 31 |
| Green Bay, US | 30 |
| Denver, US | 29 |
| Tsukuba, JP | 28 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 28 |
| Toronto, CA | 27 |
| Lincoln, US | 26 |
| Montréal, CA | 23 |
| Pullman, US | 21 |
| College Park, US | 21 |
| TUR-Alocation not on record | 21 |
| Salzburg, AT | 20 |
| KMNlocation not on record | 20 |
| Flagstaff, US | 19 |
| Provo, US | 19 |
| Beijing, CN | 17 |
| Chadron, US | 17 |
| Nagano City, JP | 17 |
| Kushiro City Museumlocation not on record | 17 |
| Spearfish, US | 15 |
| Corvallis, US | 15 |
| Staten Island, US | 15 |
| Acadia Universitylocation not on record | 14 |
| Tampa, US | 14 |
| Albuquerque, US | 13 |
| Bozeman, US | 13 |
| Philadelphia, US | 13 |
| Kyoto Universitylocation not on record | 12 |
| Odawara, JP | 12 |
| Saint Louis, US | 12 |
| Tallinn, EE | 12 |
| Provincia di Livornolocation not on record | 12 |
| Porvoo, FI | 11 |
| Yangling, CN | 11 |
| Servico de Microbiologia e Imunologialocation not on record | 11 |
| Forssa, FI | 10 |
| Dekalb, US | 10 |
| McWane Science Centerlocation not on record | 9 |
| Anchorage, US | 9 |
| Yukon Universitylocation not on record | 9 |
| IWEP FEB RASlocation not on record | 9 |
| Whitehorse, CA | 8 |
| Saint John, CA | 8 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 8 |
| ASUlocation not on record | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 8 |
| Regensburgische Botanische Gesellschaftlocation not on record | 8 |
| Millersville, US | 7 |
| Chicago, US | 7 |
| Knoxville, US | 7 |
| Boise, US | 7 |
| NMBU:MINAlocation not on record | 7 |
| Institute of the biological problems of the North FEB RASlocation not on record | 6 |
| Rocky Mountain Biological Laboratorylocation not on record | 6 |
| Phoenix, US | 6 |
| KIRMlocation not on record | 6 |
| Bern, CH | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| Science Museum of Minnesotalocation not on record | 5 |
| Durango, US | 5 |
| Brookings, US | 5 |
| Guilin, CN | 5 |
| LfUlocation not on record | 5 |
| nbflocation not on record | 5 |
| Rovaniemi, FI | 5 |
| Claremont, US | 5 |
| Chiba, JP | 5 |
| Nanjing, CN | 5 |
| Kunming, CN | 4 |
| Northeastern Forestry Universitylocation not on record | 4 |
| Bangkok, TH | 4 |
| Portland, US | 4 |
| 东北师范大学自然博物馆location not on record | 4 |
| Ypsilanti, US | 4 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 4 |
| University of Lethbridgelocation not on record | 4 |
| University of Wisconsinlocation not on record | 4 |
| Davenport, US | 4 |
| Adam Mickiewicz University in Poznańlocation not on record | 4 |
| Waverly, US | 4 |
| The Manitoba Museum, Botany Departmentlocation not on record | 4 |
| Chicago, US | 4 |
| Whitewater, US | 3 |
| Pocatello, US | 3 |
| Pittsburg, US | 3 |
| VALElocation not on record | 3 |
| Kiritappu Wetland National Trustlocation not on record | 3 |
| BClocation not on record | 3 |
| Wlocation not on record | 3 |
| Riverside, US | 3 |
| SZUlocation not on record | 3 |
| Columbia, US | 3 |
| Chapel Hill, US | 3 |
| Burlington, US | 3 |
| Angwin, US | 3 |
| Caldwell, US | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Guangzhou, CN | 2 |
| Frankfurt am Main | 2 |
| Tromso University Museumlocation not on record | 2 |
| US | 2 |
| Obihiro Centennial City Museumlocation not on record | 2 |
| Stockholm, SE | 2 |
| Otaru, JP | 2 |
| Paris, FR | 2 |
| Wellington, NZ | 2 |
| Bourges, FR | 2 |
| Logan, US | 2 |
| Santa Barbara, US | 2 |
| USFS/BHSClocation not on record | 2 |
| Siouxland Heritage Museumlocation not on record | 2 |
| ENTClocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Oswego, US | 2 |
| Trois-Rivières, CA | 2 |
| PRClocation not on record | 2 |
| Mississippi State, US | 2 |
| Canadian Museum of Naturelocation not on record | 2 |
| Miami, US | 2 |
| Emporia, US | 2 |
| UoB-IBlocation not on record | 2 |
| Williamsburg, US | 2 |
| Keene State Universitylocation not on record | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
| Walla Walla, US | 1 |
| Salamanca, ES | 1 |
| Sendai, JP | 1 |
| Jaén, ES | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Los Angeles, US | 1 |
| Nishihara, JP | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Norfolk, US | 1 |
| Blacksburg, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Toyama, JP | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Baltimore, US | 1 |
| Morgantown, US | 1 |
| Cheney, US | 1 |
| Asheville, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Fairfax, US | 1 |
| Moscow University Herbarium (MW)location not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Orem, US | 1 |
| Llocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| San Diego, US | 1 |
| Berlin, DE | 1 |
| Ashland, US | 1 |
| KR | 1 |
| Bend, US | 1 |
| SEINetlocation not on record | 1 |
| Heilongjiang Academy of Scienceslocation not on record | 1 |
| Urumqi, CN | 1 |
| DULlocation not on record | 1 |
| San Angelo, US | 1 |
| Chicago, US | 1 |
| Fargo, US | 1 |
| Kew, GB | 1 |
| GJOlocation not on record | 1 |
| Northridge, US | 1 |
| CASlocation not on record | 1 |
| MAlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Decorah, US | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Dover, US | 1 |
| Mlocation not on record | 1 |
| València, ES | 1 |
222 institutions · 7 242 of 7 322 vouchered records shown · 71 without an institution code
09Environmental DNA16 detections
Where the DNA of Stellaria longifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map4 countries0
Riparian Meadow-ShrubUnder the woods by the roadsideSedge-Grass-Moss Fen
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.2 °C 5.90–18.0
Seasonal swing summer↔winter39.0 °C
Max temp (day)18.8 °C 8.40–23.0
Min temp (night)9.50 °C 2.40–13.5
Precipitation77.6 mm/mo 53.8–83.9
Air humidity59.9 % 57.0–64.8
Moisture balance-26.4 mm/mo
Vapour deficit596 Pa 388–893
Wind speed3.50 m/s
Cloud cover42.0 % 39.9–61.5
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.