Stellaria graminea
speciesAt a glance
Occurrence records544 630
Data sources12
Biological traits66
DNA specimens49
eDNA detections27
Sources12 archives
Databases and archives Stellaria graminea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility544 630 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics49 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources66 traits
Occurrence & distributionGBIF544 630 records
Environmental DNA3 datasets · 8 countries27 detections
DNA & barcodingBOLD · NCBI49 specimens
Genome at a glanceCCDB · GoaT1.1 Gbp
01Narrative
La Stellaire graminée ou Stellaire à feuilles de graminée est une plante herbacée de la famille des Caryophyllacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology25
Fruit length4.05 mm
⚠ sources differ — AusTraits: 4.05 mm · GIFT: 3.5 mm
Fruit length max3.5 mm
Fruit length min3.5 mm
Fruit width2.4 mm
Leaf length16.5 mm
⚠ sources differ — AusTraits: 16.5 mm · GIFT: 22.5 mm
Leaf length max40 mm
Leaf length min5 mm
Leaf mass3.0 mg
Leaf size51.25 mm²
⚠ sources differ — TRY: 51.25 mm² · LEDA: 66 mm² · GIFT: 76.33 mm²
Leaf width3 mm
Leaf width max4 mm
Leaf width min1.5 mm
Plant height0.353 m
⚠ sources differ — GIFT: 0.353 m · LEDA: 0.2 m · TRY: 0.362 m
Plant height generative0.162 m
Plant height max0.9 m
Plant height min0.1 m
Seed length1.0 mm
⚠ sources differ — TRY: 1.0 mm · AusTraits: 0.9 mm · GIFT: 1 mm
Seed length max1 mm
Seed length min1 mm
Seed mass0.274 mg
⚠ sources differ — TRY: 0.274 mg · AusTraits: 0.28 mg · LEDA: 0.304 mg · GIFT: 0.299 mg
Seed mass max0.273 mg
Seed mass min0.27 mg
Seed volume0.23 mm³
Seed volume max0.23 mm³
Seed volume min0.23 mm³
Life cycle & reproduction15
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscencedehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flowering endJul
Flowering startMay
Flowering timeyynnnnnnnnny
Life formperennial or rhizomatous geophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number209
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 150 m
Elevation mean2 775 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTcrop fields, meadows, old fields, shrubberies
Leaf compoundnesssimple
Leaf shapelinear narrowly_ovate obovate
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio18.73 g/g
Leaf c442 mg/g
Leaf dry-matter content (LDMC)200 mg/g
⚠ sources differ — TRY: 200 mg/g · LEDA: 166 mg/g
Leaf n26.15 mg/g
Leaf p0.89 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)8.54 mm²/mg
⚠ sources differ — TRY: 8.54 mm²/mg · LEDA: 27.73 mm²/mg · GIFT: 28.95 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
05DNA & barcoding49 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stellaria graminea has left across the world's sequence archives.
At a glance
DNA specimens49
Marker genes8
GenBank sequences10
eDNA detections27
Countries9
The DNA barcodea real sequence read deposited for this species
CGCCCGGTTAGCCGGTGCGTGGGTGCGGTGCCATGTCATAACATTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAG …
Stellaria graminea voucher KS23 HER0297 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★trnL-F★ITS4★ITS1★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Stellaria graminea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 075 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Stellaria graminea1.08 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidypolyploid inferred
Chromosome records26–522n range26median26mode44records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2626×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · iapt +11
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · iapt
CCDB · brit-fl — Blackburn, K.B., Morton, J.K. New Phytol. 56: 344-351 (1957)
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. III. Caryophyllaceae Fernandes, A. & M. T. Leitao.Bol. Soc. Brot. ser. 245: 143-176(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1907
CCDB · fl-europaea — Blackburn &
CCDB · poland — Pogan E., Jankun A., Sawicka Z. et al. 1989. Further studies in chromosome numbers of Polish Angiosperms. Part XXII. Acta Biol. Cracov. Ser. Bot. 31, 1-17.
CCDB · ipcn-api-dl — Pogan, E. 1989. Further studies in chromosome numbers of Polish angiosperms. Part XXII. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & Z. Sawicka. 1990. Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · book-ipcn75-78 — 39
CCDB · book-indian_vol1 — Peterson, D. 1935, 1936 ; Rohweder, H. 1937, 1939 ; Tischler, G. 1937 ; Mattick (Tischler, G. 1950) ; LOve, A. & LOve, D. 1956b ; Fernandes, A. & Leitao, M.T. 1971 ; Tomkins, D.J. & Grant, W.F. 1978
CCDB · Cave1956 — Love & Love b
CCDB · Cave1957 — Blackburn & Morton
CCDB · CromoCat 2015 — Fernandes, A. & Leitão, M. T. (1971). Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. III. Caryophyllaceae. Bol. Soc. Brot. 45: 143-176.
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1977a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 259-261.
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1977b). Diploid Ranunculus ficaria L. in the Netherlands. Proc. Kon. Ned. Akad. Wetensch. Ser. C 80: 80-82.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1987). Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II Zapovedniki Belorussii Issledovaniia 11: 62-69.
CCDB · CromoCat 2015 — Pogan, E., A. Jankun & Z. Sawicka (1990). Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1-17.
CCDB · iapt — IAPT/IOPB Chromosome Data 26
2n 5217×CCDB · slov-fl · CCDB · poland · CCDB · ipcn-api-dl +2
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · poland — Pogan E., Jankun A., Wcis?o H. 1991. Further studies in chromosome numbers of Polish Angiosperms. Part XXIV. Acta Biol. Cracov. Ser. Bot. 33, 25-43.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Gadella, T. W. 1983. Enkele floristische en cytotaxonomische waaremingen op Schiermonnikoog. Gorteria 10: 227–229.
CCDB · ipcn-api-dl — Pogan, E. 1991. In Further studies in chromosome numbers of Polish angiosperms, part 24. Acta Biol. Cracov., Ser. Bot. 33: 28–30.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-indian_vol1 — Gadella, T.W.J. & Kliphuis, E. 1968a ; Taylor, R.L. & Mulligan, G.A. 1968
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1977a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 259-261.
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1977b). Diploid Ranunculus ficaria L. in the Netherlands. Proc. Kon. Ned. Akad. Wetensch. Ser. C 80: 80-82.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Morton, J. K. (2005). Documented chromosome numbers 2005: 3. Chromosome numbers in North American species of Silene and Stellaria (Caryophyllaceae) Sida 21(3): 1669–1674
2n 399×CCDB · slov-fl · CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · slov-fl — Feráková V., 1983: Kariotaksonomicheskie primechaniya k izbrannym vidam vysshikh rastenii Bratislavy i ee okrestnostei, pp. 135-138. - In: Anonymus (ed.), Ekologicheskaya kooperatsiya. Informatsionnyi byulleten´ po probleme III "Okhrana ekosistem (biogeotsenozov) i landshafta". Prilozhenie No 2. Koordinatsionnyi tsentr stran-chlenov SEV i SFRYU & Institut eksperimental´noi biologii i ekologii SAN, Bratislava.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · book-indian_vol1 — Gadella, T.W.J. & Kliphuis, E. 1967
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1977a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 259-261.
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1977b). Diploid Ranunculus ficaria L. in the Netherlands. Proc. Kon. Ned. Akad. Wetensch. Ser. C 80: 80-82.
CCDB · CromoCat 2015 — Morton, J. K. (2005). Documented chromosome numbers 2005: 3. Chromosome numbers in North American species of Silene and Stellaria (Caryophyllaceae) Sida 21(3): 1669–1674
2n 421×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Harmaja, H. (1992). A new chromosome number for Finnish Stellaria graminea (Caryophyllaceae) Annales Botanici Fennici 29: 325-327
n 265×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — UOTILA, P. & K. Pellinen. 1985. Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type544 630 records
Wild obs. + sensor522 920
Museum / vouchered19 296
Cultivated / captive315
Other2 099
Origin
Native30 972
Introduced112
Range
Area of Occupancy AOO655 356 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy57% within 1 km
≤100 m 134 256≤1 km 117 779≤10 km 190 112>10 km 2 433
444 580 georeferenced · 78 340 without coordinates
Open the mapobservation + sensor522 920
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 1 920≤1 km 3 799≤10 km 7 004>10 km 1 269
13 992 georeferenced · 5 304 without coordinates
Open the institutions mapphysical evidence19 296
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy10% within 1 km
≤100 m 2≤10 km 1>10 km 18
21 georeferenced · 294 without coordinates
Open the mapnot free-living315
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions184 of 323 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 604 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 458 |
| Helsinki, FI | 906 |
| Moscow State Universitylocation not on record | 644 |
| LDlocation not on record | 519 |
| BFLlocation not on record | 475 |
| BRNUlocation not on record | 372 |
| TROMlocation not on record | 343 |
| Salzburg, AT | 318 |
| Olocation not on record | 308 |
| Oulu, FI | 280 |
| South Kensington, GB | 275 |
| Trondheim, NO | 238 |
| Uniwersytet Śląski w Katowicachlocation not on record | 227 |
| MeiseBGlocation not on record | 217 |
| Québec, CA | 195 |
| Chongqing Museumlocation not on record | 192 |
| Bergen, NO | 185 |
| Oskarshamn, SE | 178 |
| Tartu, EE | 168 |
| Turku, FI | 153 |
| SLU Artdatabankenlocation not on record | 149 |
| Philadelphia, US | 144 |
| BIO-UNIPIlocation not on record | 143 |
| Jyväskylä, FI | 122 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 120 |
| Uniwersytet Warszawskilocation not on record | 118 |
| Acadia Universitylocation not on record | 113 |
| Madison, US | 108 |
| Kuopio, FI | 108 |
| Université Lavallocation not on record | 105 |
| KMNlocation not on record | 91 |
| Görlitz, DE | 82 |
| Durham, US | 80 |
| TUR-Alocation not on record | 80 |
| Burlington, US | 79 |
| Tallinn, EE | 72 |
| Garðabær, IS | 69 |
| Beijing, CN | 67 |
| KIRMlocation not on record | 63 |
| Berlin, DE | 60 |
| Montréal, CA | 60 |
| Saint John, CA | 58 |
| Bronx, US | 57 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 55 |
| Provincia di Livornolocation not on record | 54 |
| Allentown, US | 54 |
| MAlocation not on record | 50 |
| Entomological Society of Latvialocation not on record | 49 |
| BDBClocation not on record | 48 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 43 |
| Karlsruhe, DE | 42 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 41 |
| 41 | |
| Auckland, NZ | 41 |
| New Haven, US | 40 |
| València, ES | 40 |
| Museo Entomologico de Leonlocation not on record | 38 |
| Uppsala, SE | 36 |
| Ann Arbor, US | 36 |
| San Sebastián, ES | 33 |
| GJOlocation not on record | 32 |
| DBF-NHMDlocation not on record | 31 |
| Bloomington, US | 30 |
| Christchurch, NZ | 29 |
| Yangling, CN | 28 |
| Kandalaksha State Nature Reservelocation not on record | 27 |
| Wellington, NZ | 27 |
| Kushiro City Museumlocation not on record | 26 |
| Wuzhou, CN | 26 |
| Bern, CH | 26 |
| Porvoo, FI | 25 |
| Wlocation not on record | 25 |
| Xining, CN | 24 |
| BClocation not on record | 24 |
| CJBGlocation not on record | 22 |
| Uniwersytet Jagiellońskilocation not on record | 21 |
| Uniwersytet Opolskilocation not on record | 21 |
| College Park, US | 21 |
| Green Bay, US | 21 |
| Zürich, CH | 20 |
| St. Paul, US | 20 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 20 |
| Adam Mickiewicz University in Poznańlocation not on record | 19 |
| Vancouver, CA | 19 |
| Saint Louis, US | 17 |
| University of Stellenboschlocation not on record | 17 |
| Kunming, CN | 16 |
| Williamsburg, US | 16 |
| ISAlocation not on record | 16 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| Salamanca, ES | 15 |
| Frankfurt am Main | 15 |
| Staten Island, US | 15 |
| Vitoria, ES | 15 |
| Barcelona, ES | 14 |
| Porrentruy, CH | 13 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 13 |
| Tula State Universitylocation not on record | 13 |
| Fulda, DE | 13 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| Institute of the biological problems of the North FEB RASlocation not on record | 12 |
| Pullman, US | 12 |
| Chapel Hill, US | 12 |
| Rovaniemi, FI | 12 |
| Philadelphia, US | 12 |
| Dekalb, US | 12 |
| WTUlocation not on record | 12 |
| Moscow, US | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| PrivatHerblocation not on record | 11 |
| Tampa, US | 11 |
| Keene State Universitylocation not on record | 11 |
| Mlocation not on record | 11 |
| Paris, FR | 11 |
| Toronto, CA | 10 |
| CASlocation not on record | 10 |
| CICYTEXlocation not on record | 9 |
| Nanjing, CN | 9 |
| Stockholm, SE | 9 |
| Odawara, JP | 8 |
| Podgorica, ME | 8 |
| SZUlocation not on record | 8 |
| Norfolk, US | 8 |
| Obihiro Centennial City Museumlocation not on record | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| University of New Hampshirelocation not on record | 7 |
| Rotorua, NZ | 7 |
| Chicago, US | 7 |
| nbflocation not on record | 7 |
| Toyama, JP | 7 |
| Logan, US | 7 |
| NMBU:MINAlocation not on record | 7 |
| Columbia, US | 7 |
| IDElocation not on record | 7 |
| PRClocation not on record | 6 |
| SWlocation not on record | 6 |
| Washington, US | 6 |
| Chengdu, CN | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Frauenfeld, CH | 6 |
| Bangkok, TH | 6 |
| Mount Annan, AU | 6 |
| Madrid, ES | 6 |
| UGentlocation not on record | 6 |
| Hobart, AU | 6 |
| Tilburg, NL | 6 |
| GZUlocation not on record | 6 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 6 |
| Kew, GB | 6 |
| Whitehorse, CA | 5 |
| Riverside, US | 5 |
| Taipei, TW | 5 |
| Zapopan, MX | 5 |
| Glarus, CH | 5 |
| Victoria, CA | 5 |
| Tsukuba, JP | 5 |
| Zürich, CH | 5 |
| Museum of the Rockieslocation not on record | 4 |
| Sion, CH | 4 |
| Denver, US | 4 |
| Otaru, JP | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Forssa, FI | 4 |
| DULlocation not on record | 4 |
| Bourges, FR | 4 |
| Philadelphia, US | 4 |
| Mohonk Preservelocation not on record | 4 |
| Whitewater, US | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Urumqi, CN | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Johnson City, US | 4 |
| BGBMlocation not on record | 4 |
| Dresden, DE | 4 |
| Corvallis, US | 4 |
| Guangzhou, CN | 4 |
| BSBIlocation not on record | 3 |
| Knoxville, US | 3 |
| Cambridge, US | 3 |
| Chengdu, CN | 3 |
| Gijón, ES | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Winterthur, CH | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Morgantown, US | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Museo Achille Folettolocation not on record | 3 |
| WINlocation not on record | 3 |
| Fairfax, US | 3 |
| Seoul, KR | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Granada, ES | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Brookings, US | 3 |
| Ypsilanti, US | 3 |
| JP | 3 |
| Pamplona, ES | 3 |
| Badajoz, ES | 3 |
| Guilin, CN | 3 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 3 |
| Pocatello, US | 2 |
| Brussel, BE | 2 |
| University of Alberta Museumslocation not on record | 2 |
| Lausanne, CH | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Yugra State University Biological Collectionlocation not on record | 2 |
| *unvoucheredlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Nagano City, JP | 2 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 2 |
| FLADlocation not on record | 2 |
| Bozeman, US | 2 |
| New Brunswick, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Alicante, ES | 2 |
| Llocation not on record | 2 |
| Hudson, US | 2 |
| Fukushima Universitylocation not on record | 2 |
| University of Wisconsinlocation not on record | 2 |
| Northridge, US | 2 |
| Pamplona, ES | 2 |
| Xiamen, CN | 2 |
| Pittsburg, US | 2 |
| Namur, BE | 2 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 2 |
| Chicago, US | 2 |
| UoB-IBlocation not on record | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Jackson, US | 2 |
| Miami, US | 2 |
| Tomioka, JP | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Missoula, US | 2 |
| Cambridge, US | 2 |
| EL PASO, US | 2 |
| Edinburgh, GB | 2 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 2 |
| Cheney, US | 2 |
| Qufu Normal Universitylocation not on record | 2 |
| Turlock, US | 1 |
| Nishihara, JP | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Henderson, US | 1 |
| Davenport, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| San Diego, US | 1 |
| GAlocation not on record | 1 |
| Tacoma, US | 1 |
| Flagstaff, US | 1 |
| Chiba, JP | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| Long Beach, US | 1 |
| LUXEMBOURG, LU | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Sendai, JP | 1 |
| IPE-CSIClocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Culiacán, MX | 1 |
| US | 1 |
| Torreón, MX | 1 |
| Montecillo, Texcoco, MX | 1 |
| Shinshu Universitylocation not on record | 1 |
| Portland, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| AASlocation not on record | 1 |
| Monastir, TN | 1 |
| Macomb, US | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Adelaide, AU | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Fort Worth, US | 1 |
| Mount Pleasant, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Phoenix, US | 1 |
| Dhaka, BD | 1 |
| Fredericksburg, US | 1 |
| Boumlocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Millersville, US | 1 |
| Claremont, US | 1 |
| Göteborg, SE | 1 |
| Tromso University Museumlocation not on record | 1 |
| Hangzhou, CN | 1 |
| Santa Barbara, US | 1 |
| Angwin, US | 1 |
| Waverly, US | 1 |
| Durham, US | 1 |
| Siberian Federal Universitylocation not on record | 1 |
| Harrisonburg, US | 1 |
| Richmond, US | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| WNNUlocation not on record | 1 |
| Siouxland Heritage Museumlocation not on record | 1 |
| Cochabamba, BO | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Jaén, ES | 1 |
| Jefferson City, US | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| AUAlocation not on record | 1 |
| Irvine, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Canberra, AU | 1 |
| Hamilton, US | 1 |
323 institutions · 17 725 of 19 296 vouchered records shown · 1 269 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA27 detections
Where the DNA of Stellaria graminea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found27
Studies independent surveys3
Countries8
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 27 detections have coordinates
Open the map8 countries0
MeadowPalearctic
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.8 °C 8.80–19.9
Seasonal swing summer↔winter15.2 °C
Max temp (day)18.9 °C 10.4–25.4
Min temp (night)11.9 °C 6.40–14.1
Precipitation74.6 mm/mo 21.3–95.5
Air humidity60.8 % 53.4–63.6
Moisture balance-40.0 mm/mo -118–3.70
Vapour deficit691 Pa 425–1,082
Wind speed3.70 m/s 2.60–4.60
Cloud cover46.2 % 35.1–53.2
CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.