Stellaria flaccida

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Stellaria

At a glance

Occurrence records8 910

Data sources3

Biological traits39

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Stellaria flaccida's data was compiled from.

GBIFGlobal Biodiversity Information Facility8 910 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources39 traits

Occurrence & distributionGBIF8 910 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology13

Fruit length6.1 mm

Fruit width4.2 mm

Leaf length13 mm

Leaf length max18 mm

Leaf length min7 mm

Leaf size113 mm²

Leaf width4 mm

Leaf width max8 mm

Leaf width min2 mm

Petiole length0.4 cm

Plant height0.325 m

Seed length1.5 mm

Seed width0.99 mm

Life cycle & reproduction12

Dehiscencedehiscent

Dispersal typeanimal

Flowering endJan

Flowering startSep

Flowering timeynnnnnnnyyyy

Life spanperennial

⚠ sources differ — AusTraits: perennial · GIFT: annual

Lifespan years52.5 years

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate ovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stellaria flaccida has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT624609.1 ↗479 bpAustralia

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAGCGACCAGCGAACACGTTTAACTCTCTCGGGCGTCGGGA …

Stellaria flaccida voucher B 21321 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type8 910 records

Wild obs. + sensor8 539

Museum / vouchered371

Origin

Native89

Introduced1

Range

Area of Occupancy AOO17 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 6 992≤1 km 890≤10 km 173>10 km 35

8 090 georeferenced · 449 without coordinates

Open the mapobservation + sensor8 539

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 43≤1 km 100≤10 km 159>10 km 22

324 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence371

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	97
Mount Annan, AU	90
Canberra, AU	56
Hobart, AU	43
Adelaide, AU	16
Brisbane, AU	15
Armidale, AU	13
Batemans Bay, AU	13
Wollongong, AU	5
Parkville, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4
La Trobe Universitylocation not on record	4
Wellington, NZ	3
QVMAGlocation not on record	3
Logan, US	1
Stockholm, SE	1
John T. Waterhouse Herbariumlocation not on record	1
Auckland, NZ	1

18 institutions · 371 of 371 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stellaria flaccida

At a glance

Sources3 archives

Size & morphology13

Life cycle & reproduction12

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type8 910 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Record type8 910 records