Stellaria borealis
Bigelow · speciesAt a glance
Occurrence records8 349
Data sources8
Biological traits13
DNA specimens24
eDNA detections11
Sources8 archives
Databases and archives Stellaria borealis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility8 349 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics24 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources13 traits
Occurrence & distributionGBIF8 349 records
Environmental DNA1 datasets · 3 countries11 detections
DNA & barcodingBOLD · NCBI24 specimens
Genome at a glanceCCDB2n = 24
01Narrative
Stellaria borealis — вид трав'янистих рослин родини Гвоздичні (Caryophyllaceae). Етимологія: лат. borealis — «північний».
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPLEDAGIFTTRY
Size & morphology2
Plant height max0.15 m
Seed mass0.176 mg
Life cycle & reproduction3
Life formsubshrub
Life spanperennial
Seed number51.85
Diet & foraging1
Parasiteindependent
Habitat & environment6
Aquaticterrestrial
Climatesubalpine or subarctic
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC3
05DNA & barcoding24 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stellaria borealis has left across the world's sequence archives.
At a glance
DNA specimens24
Marker genes8
GenBank sequences8
eDNA detections11
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCG …
Stellaria borealis voucher CCDB-18328-F6 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★matK-like★rbcL4★rbcL-like★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Stellaria borealis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidypolyploid inferred
Chromosome records24–522n range24median24mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2424×CCDB · slov-fl · CCDB · brit-fl · CCDB · iber-fl +10
CCDB · slov-fl — Migra V., 1982: Zytotaxonomische Probleme ausgewählter Taxa der Flora des Babia Hora - Bergmassivs (Gebirge Západné Beskydy) I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 29: 87-95.
CCDB · brit-fl — Blackburn, K.B., Morton, J.K. New Phytol. 56: 344-351 (1957)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Bot. J. Scotl. : ()
CCDB · iber-fl — The incidence of polyploidy in the Caryophyllaceae of Britain and of Portugal. Blackburn, K. B. & J. K. Morton.New Phytol.56: 344-351(1957).
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. III. Caryophyllaceae Fernandes, A. & M. T. Leitao.Bol. Soc. Brot. ser. 245: 143-176(1971).
CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1908
CCDB · fl-europaea — Blackburn &
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Morton, J. K. 2005. Documented chromosome numbers 2005: 3. Chromosome numbers in North American species of Silene and Stellaria (Caryophyllaceae). Sida 21(3): 1669–1674.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Pogan, E. 1980. Further studies in chromosome numbers of Polish Angiosperms. Acta Biol. Cracov., Ser. Bot. 22: 129–153.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.T. LEITAO. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal III. Cariophyllaceae. Bol. soc. Brot. 45 (ser. 2): 143-176.
CCDB · book-ipcn67-71 — GADELLA, T.W.J., & E. KLIPHUIS. 1971. Chromosome numbers of flowering plants in the Netherlands v. Proc. Kon. Ned. Acad. Wetensch. ser C 74:
CCDB · book-ipcn73-74 — FINDLAY, J.N., & J. MCNEILL. 1973. In IOPB chromosome number reports XL. Taxon 22: 285-291.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · book-indian_vol1 — Peterson, D. 1935, 1936 ; Rohweder, H. 1939 ; Blackburn, K.B. & Morton, J.K. 1957 ; Quezel, P. 1957
CCDB · book-atlas-flowering-plants — Rohweder 1939
CCDB · Cave1957 — Blackburn & Morton
CCDB · CromoCat 2015 — Pogan, E. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov., Ser. Bot. 22: 129-153.
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
2n 525×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora
CCDB · ipcn-api-dl — Morton, J. K. & R. K. Rabeler. 1989. Biosystematic studies on the Stellaria calyeantha (Caryophyllaceae). I. Cytology and cytogeography. Canad. J. Bot. 67: 121–127.
CCDB · book-ipcn67-71 — HARTMAN, R.L. 1971. Chromosome numbers in Caryophyllaceae from Wyoming and adjacent states. Bull. Torrey Bot. Club 98: 276-280.
CCDB · eflora
2n 263×CCDB · brit-fl · CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants
CCDB · brit-fl — McAllister, H. (1993)
CCDB · book-indian_vol1 — Mattick (Tischler, G. 1950)
CCDB · book-atlas-flowering-plants — Mattick, T. 1950
2n 361×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
2n 391×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Morton, J. K. & R. K. Rabeler. 1989. Biosystematic studies on the Stellaria calyeantha (Caryophyllaceae). I. Cytology and cytogeography. Canad. J. Bot. 67: 121–127.
n 262×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Morton, J. K. & R. K. Rabeler. 1989. Biosystematic studies on the Stellaria calyeantha (Caryophyllaceae). I. Cytology and cytogeography. Canad. J. Bot. 67: 121–127.
CCDB · ipcn-api-dl — Morton, J. K. 2005. Documented chromosome numbers 2005: 3. Chromosome numbers in North American species of Silene and Stellaria (Caryophyllaceae). Sida 21(3): 1669–1674.
n 121×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type8 349 records
Wild obs. + sensor6 117
Museum / vouchered2 225
Other7
Range
Area of Occupancy AOO23 444 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy81% within 1 km
≤100 m 1 762≤1 km 3 165≤10 km 1 089>10 km 32
6 048 georeferenced · 69 without coordinates
Open the mapobservation + sensor6 117
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 245≤1 km 674≤10 km 483>10 km 343
1 745 georeferenced · 480 without coordinates
Open the institutions mapphysical evidence2 225
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions47 of 79 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Olocation not on record | 583 |
| Helsinki, FI | 315 |
| LDlocation not on record | 234 |
| Oulu, FI | 208 |
| TROMlocation not on record | 200 |
| Trondheim, NO | 128 |
| Turku, FI | 81 |
| Oskarshamn, SE | 52 |
| SLU Artdatabankenlocation not on record | 43 |
| Bergen, NO | 38 |
| Ann Arbor, US | 35 |
| Garðabær, IS | 21 |
| Kuopio, FI | 18 |
| Missoula, US | 13 |
| KMNlocation not on record | 12 |
| nbflocation not on record | 10 |
| TUR-Alocation not on record | 10 |
| Saint John, CA | 9 |
| Bozeman, US | 9 |
| Bloomington, US | 8 |
| Québec, CA | 8 |
| Jyväskylä, FI | 8 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 8 |
| Green Bay, US | 7 |
| Stockholm, SE | 7 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 7 |
| NMBU:MINAlocation not on record | 7 |
| Yukon Universitylocation not on record | 7 |
| Madison, US | 6 |
| University of Alberta Museumslocation not on record | 6 |
| Vancouver, CA | 6 |
| 6 | |
| Rocky Mountain Biological Laboratorylocation not on record | 5 |
| Pullman, US | 5 |
| BRNUlocation not on record | 5 |
| Rovaniemi, FI | 5 |
| Acadia Universitylocation not on record | 5 |
| Uppsala, SE | 4 |
| Université Lavallocation not on record | 4 |
| Corvallis, US | 4 |
| Tampa, US | 3 |
| WTUlocation not on record | 3 |
| Emporia, US | 3 |
| Victoria, CA | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Whitehorse, CA | 3 |
| St. Paul, US | 3 |
| Provo, US | 2 |
| Chongqing Museumlocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Moscow, US | 2 |
| Finnish Museum of Natural Historylocation not on record | 2 |
| Kandalaksha State Nature Reservelocation not on record | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Denver, US | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Washington, US | 1 |
| Philadelphia, US | 1 |
| Montréal, CA | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Wlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Tempe, US | 1 |
| Bronx, US | 1 |
| Porvoo, FI | 1 |
| Logan, US | 1 |
| Moscow State Universitylocation not on record | 1 |
| University of British Columbialocation not on record | 1 |
| Berlin, DE | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Ashland, US | 1 |
| Paris, FR | 1 |
| Cheney, US | 1 |
| Claremont, US | 1 |
| Portland, US | 1 |
| BClocation not on record | 1 |
| Toronto, CA | 1 |
| Mississippi State, US | 1 |
| BioFokuslocation not on record | 1 |
79 institutions · 2 207 of 2 225 vouchered records shown · 18 without an institution code
09Environmental DNA11 detections
Where the DNA of Stellaria borealis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map3 countries0
Sandy shore of river.Front yard of cabin in White Spruce forest.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.5 °C 11.3–14.4
Seasonal swing summer↔winter29.8 °C
Max temp (day)17.1 °C 14.0–19.3
Min temp (night)7.40 °C 6.70–9.30
Precipitation81.7 mm/mo 60.1–137
Air humidity59.0 % 55.9–62.6
Moisture balance-4.40 mm/mo -70.4–41.6
Vapour deficit599 Pa 512–682
Wind speed3.00 m/s 1.30–4.30
Cloud cover47.0 % 34.6–63.4
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.