Stelis immersa

(Linden & Rchb.f.) Pridgeon & M.W.Chase · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Stelis

At a glance

Occurrence records58

Data sources8

Biological traits11

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Stelis immersa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Stelis immersa is a species of orchid found from Mexico to northern Venezuela.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 000 m

Elevation mean2 000 m

Elevation min1 000 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stelis immersa has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences6

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSMK294837.1 ↗623 bp

ACGT

TCGAGACCGAATATACCGAGCGATTCGGAGAACCTGTGAACGAACGATGGCACTCGCCGTCGCGTAACGGCCGTCCCTGTTGTCGGCCCC …

Stelis immersa internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type58 records

Wild obs. + sensor30

Museum / vouchered27

Cultivated / captive1

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 17≤1 km 6>10 km 2

25 georeferenced · 5 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 12

12 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence27

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	8
Museo Nacional de Costa Rica (MNCR)location not on record	7
Durango, MX	5
Saint Louis, US	3
Tapachula, MX	2
Guatemala City, GT	1
Tuxtla Gutiérrez, MX	1

7 institutions · 27 of 27 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Stelis immersa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)