Stegostoma fasciatum

(Hermann, 1783) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Orectolobiformes/Stegostomatidae/Stegostoma

At a glance

Occurrence records1 461

Data sources11

Biological traits0

DNA specimens56

eDNA detections54

Sources11 archives

Databases and archives Stegostoma fasciatum's data was compiled from.

WikipediaWikimedia Foundation18 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 461 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADWarticle

Occurrence & distributionGBIF1 461 records

Environmental DNA2 datasets · 9 countries54 detections

DNA & barcodingBOLD56 specimens

Genome at a glanceGoaT · NCBI≈3.2 Gbp

01Narrative

Zebra sharks range from about 2.5 m to 3.0 m in length. The largest zebra shark captured wasabout 3.5 m in length. The body is cylindrical with lateral ridges and a tail as long as the body. The head is broad with large eyes and a transverse mouth just below them. Five gill slits are present on the side of the head. The anterior dorsal fin is larger than the posterior and the gray body is covered in dark brown spots.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stegostoma fasciatum has left across the world's sequence archives.

At a glance

DNA specimens56

BINs1

Marker genes11

eDNA detections54

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

73Amostly conserved

166Gmostly conserved

198Tmostly conserved

304Gmostly conserved

CCTTTACCTGATTTTTGGTGCATGAGCAGGAATAGTAGGACTAGCTCTTAGCCTTTTAATCCGAGCTGAACTAAGCCAACCTGGGTCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes3

BIN1

Most divergent pair0.46%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rhincodon typussame order11.1%Nebrius ferrugineussame order11.3%Ginglymostoma cirratumsame order11.9%Chiloscyllium punctatumsame order13.0%Paragaleus randallisame order15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

06Genome at a glanceGoaT · NCBI

The complete instruction manual Stegostoma fasciatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈3 198 515 386 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Stegostoma fasciatum3.2 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type1 461 records

Wild obs. + sensor1 379

Museum / vouchered70

Cultivated / captive8

Other4

Origin

Native5

Range

Area of Occupancy AOO1 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 64≤1 km 1 261>10 km 9

1 334 georeferenced · 45 without coordinates

Open the mapobservation + sensor1 379

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 2≤10 km 26>10 km 3

31 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence70

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 8

8 georeferenced

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DEWlocation not on record	25
Paris, FR	17
Los Angeles, US	5
FishBaselocation not on record	3
CASlocation not on record	3
	2
South African Institute for Aquatic Biodiversitylocation not on record	2
Cambridge, US	2
ICM-CSIClocation not on record	2
Washington, US	1
Toronto, CA	1
Natural History Museum Rotterdamlocation not on record	1
Curtin Universitylocation not on record	1
Brussels, BE	1
Chicago, US	1
Copenhagen, DK	1

16 institutions · 68 of 70 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA54 detections

Where the DNA of Stegostoma fasciatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys2

Countries9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.5–32.8

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 25.3–41.0

Min temp (night)22.5 °C 19.3–25.3

Precipitation36.7 mm/mo 0.2–109

Air humidity52.0 % 47.5–61.7

Moisture balance-50.8 mm/mo

Vapour deficit1,616 Pa 1,164–2,572

Wind speed3.20 m/s

Cloud cover24.8 % 4.30–29.2

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stegostoma fasciatum

At a glance

Sources11 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 461 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 461 records