Steccherinum straminellum

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Steccherinaceae/Steccherinum

At a glance

Occurrence records10

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Steccherinum straminellum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility10 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 records

DNA & barcodingNCBIsequences

01Narrative

Steccherinum straminellum is a toothed crust fungus of the family Steccherinaceae. It was first described by Giacomo Bresadola in 1902 as Odontia straminella. The type collection was made in Portugal by Camille Torrend. After examining the type specimen, Ireneia Melo transferred the species to the genus Steccherinum in 1995.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Steccherinum straminellum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR600264.1 ↗498 bpSouth Korea · 2018

ACGT

CATTAAAGAATACGAATTTGAGTGGGGTTGTTGCTGGCCTTCCGACGGGCACGTGCACGCTTCGTTCATTTTTTTATTTTACACCCCTGT …

Steccherinum straminellum voucher KUC20181101_53 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type10 records

Wild obs. + sensor3

Museum / vouchered7

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Sebastián, ES	2
Chicago, US	1
Olocation not on record	1
Auckland, NZ	1
Helsinki, FI	1

5 institutions · 6 of 7 vouchered records shown · 1 without an institution code