Stayneria neilii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Stayneria

At a glance

Occurrence records41

Data sources4

Biological traits11

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Stayneria neilii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF41 records

DNA & barcodingNCBIsequences

01Narrative

Stayneria L.Bolus est un genre de plante de la famille des Aizoaceae. Stayneria L.Bolus, in J. S. African Bot. 27: 47 (1960) Type : Stayneria littlewoodii L.Bolus

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max1.5 m

Seed mass1.57 mg

Life cycle & reproduction2

Life formsucculent shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max700 m

Elevation min300 m

Epiphyteterrestrial

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stayneria neilii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKF132764.1 ↗776 bp

ACGT

TACTGGGTAAAAGATGCCTCCTCTTTGCATTTATTACGATTCTTTCTTTATGGGTATCATAATTGGAATAGTCTTATTACTTCAAAAGAA …

Stayneria neilii voucher Bruyns 11774 (BOL) maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor32

Museum / vouchered9

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 29≤1 km 1>10 km 2

32 georeferenced

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	6
Pretoria, ZA	2
South African National Biodiversity Institutelocation not on record	1

3 institutions · 9 of 9 vouchered records shown