Stangeria eriopus

(Kunze) Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Cycadopsida/Cycadales/Zamiaceae/Stangeria

At a glance

Occurrence records398

Data sources13

Biological traits18

DNA specimens23

eDNA detections16

Sources13 archives

Databases and archives Stangeria eriopus's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility398 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS25 compounds

Occurrence & distributionGBIF398 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD · NCBI23 specimens

Genome at a glanceCCDB · GoaT16.8 Gbp

01Narrative

Stangeria eriopus is a cycad endemic to southern Africa. It is the sole species in the genus Stangeria, most closely related to the Australian genus Bowenia, with which it forms the family Stangeriaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height min0.4 m

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 300 m

Elevation min15 m

Epiphyteterrestrial

Growth formherb

Woodinesswoody

Physiology & chemistry4

Leaf c479 mg/g

Leaf n21.5 mg/g

Leaf p1.14 mg/g

Specific leaf area (SLA)13.7 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition25 compounds

Compounds documented for Stangeria eriopus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aminoacids13

Azo and Azoxy alkaloids4

Unsaturated fatty acids3

Cholestane steroids $ Stigmastane steroids1

Branched fatty acids $ Unsaturated fatty acids1

Documented compounds25 total

Tissue Source Quantified only

Compound	Amount	Source
(E)-methyl-oxido-[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethylimino]azanium	present	LOTUS
3-Aminopropanoic acid	present	LOTUS
4-aminobutanoate	present	LOTUS
beta-Sitosterol	present	LOTUS
Cycasin	present	LOTUS
d,l-Serine	present	LOTUS
D-Alanine	present	LOTUS
D-Aspartic acid	present	LOTUS
Eicosanic acid	present	LOTUS
Glycine	present	LOTUS

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stangeria eriopus has left across the world's sequence archives.

At a glance

DNA specimens23

Marker genes7

GenBank sequences10

eDNA detections16

Countries2

The DNA barcodea real sequence read deposited for this species

ITSON832212.1 ↗1 276 bp

ACGT

GGTGGCCAGTTCTCGTCTGCGTCCTCGACCGCTTCCGTCGTCGATGGCGAGCCCCGGTGTCCGGCGTCCTTCGTTCGACGATCGGGGTTC …

Stangeria eriopus isolate d1006 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL7★rbcLa★ITS1PsbA-liketrnH-psbA

animal barcodeplant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Stangeria eriopus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size16 782 480 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Stangeria eriopus16.78 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 168×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Kokubugata, G., K. D. Hill, G. W. Wilson, K. Kondo & L. M. Randall. 2001. A comparison of chromosome number and karyotype in somatic chromosomes of Stangeriaceae (Cycadales). Edinburgh J. Bot. 58: 475–481.

CCDB · ipcn-api-dl — Kokubugata, G., K. D. Hill & K. Kondo. 2002. Ribosomal DNA distribution in somatic chromosomes of Stangeria eriopus (Stangeriaceae, Cycadales) and molecular-cytotaxonomic relationships to some other cycad genera. Brittonia 54(1): 1–5.

CCDB · ipcn-api-dl — Kokubugata, G. 2004. Mapping 5S ribosomal DNA on somatic chromosomes of four species of Ceratozamia and Stangeria eriopus (Cycadales). Bot. J. Linn. Soc. 145: 499–504.

CCDB · book-ipcn67-71 — MARCHANT, C.J. 1968. Chromosome patterns and nuclear phenomena in the cycad families Stangeriaceae and zamiaceae. Chromosoma 24: 100-134.

CCDB · book-atlas-flowering-plants — Sax & B. 1934

CCDB · Rastogi2019 — Kokubugata G, Hill KD, Kondo K. Ribosomal DNA distribution in somatic chromosomes of Stangeria eriopus (Stangeriaceae, Cycadales) and molecular-cytotaxonomic relationships to some other cycad genera. Brittonia. 2002;54:1–5. ; Kokubugata G, Hill KD, Wilson GW, Kondo K, Randall LM. A comparison of chromosome number and karyotype in somatic chromosomes of Stangeriaceae (Cycadales). Edinb J Bot. 2001; 58:475–81. ; Kokubugata G, Vovides AP, Kondo K. Mapping 5S ribosomal DNA on somatic chromosomes of four species of Ceratozamia and Stangeria eriopus (Cycadales). Bot J Linn Soc. 2004;145:499–504.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type398 records

Wild obs. + sensor360

Museum / vouchered34

Cultivated / captive4

Range

Area of Occupancy AOO1 388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤1 km 4≤10 km 1>10 km 337

342 georeferenced · 18 without coordinates

Open the mapobservation + sensor360

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 3≤1 km 2≤10 km 1

6 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence34

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	10
University of Johannesburglocation not on record	5
Miami, US	5
Zürich, CH	2
Saint Louis, US	2
GRAlocation not on record	1
Knoxville, US	1
US	1
Wlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Edinburgh, GB	1
OTSlocation not on record	1

12 institutions · 31 of 34 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA16 detections

Where the DNA of Stangeria eriopus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 20.4–22.7

Seasonal swing summer↔winter10.8 °C

Max temp (day)26.4 °C 25.6–27.7

Min temp (night)17.1 °C 15.3–17.2

Precipitation128 mm/mo 111–143

Air humidity56.4 % 56.4–60.0

Moisture balance-36.7 mm/mo -50.5–-1.00

Vapour deficit1,043 Pa 1,001–1,203

Wind speed1.60 m/s 1.50–3.10

Cloud cover36.1 % 34.9–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)