Stackhousia viminea

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Stackhousia

At a glance

Occurrence records4 272

Data sources9

Biological traits37

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Stackhousia viminea's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility4 272 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF4 272 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Stackhousia viminea the Slender Stackhousia is a common small Australian plant. It grows to 70 cm tall. The habitat is heathland, pastures, eucalyptus woodland and forest, usually in moist areas. It features attractive yellowish/red flowers. The specific epithet viminea refers to the slender stems. The genus is named after the botanist and artist, John Stackhouse.Les Robinson - Field Guide to the Native Plants of Sydney, page 133 First collected at Sydney by John White. And described a few years later by the prolific English botanist James Smith.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length2.25 mm

Leaf length22.5 mm

Leaf length max40 mm

Leaf length min4 mm

Leaf mass per area168 g/m2

Leaf size136 mm²

Leaf width4.55 mm

Leaf width max8 mm

Leaf width min1.5 mm

Plant height0.7 m

⚠ sources differ — AusTraits: 0.7 m · TRY: 0.6 m

Plant height max0.7 m

Seed length2.2 mm

Seed mass1.84 mg

⚠ sources differ — TRY: 1.84 mg · AusTraits: 2.56 mg

Seed width1 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyyyyynnnyyyy

Life formperennial or shrub

Life spanannual

⚠ sources differ — TRY: annual · AusTraits: perennial · GIFT: perennial

Pollination syndromeinsect

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formherb

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical narrowly_obovate obovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stackhousia viminea has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU169111.1 ↗597 bpAustralia

ACGT

TCGAAACCTGCCGAAACAGAATGACTGCGAACTGGTTGGAATAAGTGGGCTGGTGGGGTGTCCTAAAGGATGCCCGATCACAGAGGCCGA …

Stackhousia viminea voucher BRI:665139 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Stackhousia viminea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wiltshire, R. J. E. & W. D. Jackson. 2003. Index of chromosome numbers of Tasmanian spermatophytes. Pap. & Proc. Roy. Soc. Tasmania 137: 39–53.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 272 records

Wild obs. + sensor3 578

Museum / vouchered617

Cultivated / captive2

Other75

Origin

Native101

Range

Area of Occupancy AOO10 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 2 829≤1 km 358≤10 km 155>10 km 30

3 372 georeferenced · 206 without coordinates

Open the mapobservation + sensor3 578

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 155≤1 km 74≤10 km 202>10 km 62

493 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence617

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	151
Canberra, AU	106
Mount Annan, AU	94
Museo Entomologico de Leonlocation not on record	75
Armidale, AU	60
NSW Dept of Planning, Industry and Environmentlocation not on record	39
Hobart, AU	14
Kew, GB	13
Batemans Bay, AU	8
QVMAGlocation not on record	8
Wollongong, AU	7
Smithfield, AU	6
John T. Waterhouse Herbariumlocation not on record	5
Palmerston, AU	4
Parkville, AU	3
Auckland, NZ	3
University of Stellenboschlocation not on record	2
Paris, FR	1
China Agricultural Universitylocation not on record	1
Adelaide, AU	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Riverside, US	1
Claremont, US	1
GJOlocation not on record	1
Stockholm, SE	1
La Trobe Universitylocation not on record	1

27 institutions · 608 of 617 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Stackhousia viminea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stackhousia viminea

At a glance

Sources9 archives

Size & morphology14

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 272 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 272 records