Stackhousia muricata

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Stackhousia

At a glance

Occurrence records1 845

Data sources6

Biological traits35

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Stackhousia muricata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 845 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF1 845 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Stackhousia muricata is a species of plant in the family Celastraceae. The annual or perennial herb typically grows to a height of 0.03 to. It blooms between July and November producing yellow-green-brown flowers. The species is found from the Pilbara through the Mid West and Goldfields-Esperance into the northern Great Southern region of Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length2.85 mm

Leaf length18.5 mm

Leaf length max30 mm

Leaf length min7 mm

Leaf width1.75 mm

Leaf width max2.5 mm

Leaf width min1 mm

Plant height0.55 m

Plant height max0.6 m

Plant height min0.03 m

Seed mass2.56 mg

Seed mass max2.56 mg

Seed mass min2.56 mg

Life cycle & reproduction8

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life formperennial or annual

Life spanannual perennial

⚠ sources differ — AusTraits: annual perennial · GIFT: annual

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stackhousia muricata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU169123.1 ↗608 bpAustralia

ACGT

TCGAAACTTGACCCAAAGGAACGATCGCGAACAGGTTCGAATAAACATGCGGTTGGGGAGCTGTAATTGACCCCTGACCGCAGCGGCTGA …

Stackhousia muricata voucher AD:98952198 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type1 845 records

Wild obs. + sensor1 343

Museum / vouchered481

Other21

Origin

Native84

Range

Area of Occupancy AOO5 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 283≤1 km 31≤10 km 21>10 km 3

1 338 georeferenced · 5 without coordinates

Open the mapobservation + sensor1 343

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 199≤1 km 42≤10 km 179>10 km 17

437 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence481

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	131
Adelaide, AU	113
Brisbane, AU	81
NSW Dept of Planning, Industry and Environmentlocation not on record	55
Mount Annan, AU	34
Canberra, AU	24
Museo Entomologico de Leonlocation not on record	10
Armidale, AU	7
Palmerston, AU	6
BGPAlocation not on record	5
Kew, GB	3
Claremont, US	1
Wollongong, AU	1

13 institutions · 471 of 481 vouchered records shown · 10 without an institution code

09Environmental DNA2 detections

Where the DNA of Stackhousia muricata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stackhousia muricata

At a glance

Sources6 archives

Size & morphology13

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type1 845 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 845 records