Stackhousia monogyna

Labill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Stackhousia

At a glance

Occurrence records14 508

Data sources9

Biological traits38

DNA specimens5

eDNA detections6

Sources9 archives

Databases and archives Stackhousia monogyna's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility14 508 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Occurrence & distributionGBIF14 508 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Stackhousia pubescens, commonly known as downy stackhousia, is a species of plant in the family Celastraceae. The species is found from the Mid West, Wheatbelt, South West, Great Southern and Goldfields-Esperance regions of Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length2.25 mm

Leaf length30 mm

Leaf length max30 mm

Leaf mass per area67.07 g/m2

Leaf size94.25 mm²

Leaf width2 mm

Leaf width max4 mm

Leaf width min2 mm

Plant height0.65 m

Plant height max0.7 m

Plant height min0.1 m

Seed length2.2 mm

Seed mass1.93 mg

⚠ sources differ — TRY: 1.93 mg · AusTraits: 2.04 mg · GIFT: 1.96 mg

Seed mass max2.16 mg

Seed mass min1.77 mg

Seed width1.5 mm

Life cycle & reproduction9

Dispersal typeanimal

Flowering timennnnnnnyyyyy

Life formperennial or shrub

Life spanperennial

Lifespan years6 years

Pollination syndromeinsect

Reproductive maturity1.5 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate strap-shaped widely_elliptical

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stackhousia monogyna has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences4

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY935887.1 ↗282 bp

ACGT

TCGAAACCTGCCCTAACGGAACGATCGCGAACCGGTTATACTCAACAGTCGGTCGGGGAGCCGGTAACGGAACCCCGACCGCGGCCGCCG …

Stackhousia monogyna isolate 24 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Stackhousia monogyna carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Turner 1966

CCDB · book-fedorov — Jackson w, D.

CCDB · book-fedorov — D. 1955)

CCDB · book-atlas-flowering-plants — W. D. Jackson unp.

n 102×CCDB · ipcn-api-dl · CCDB · book-ipcn66

CCDB · ipcn-api-dl — Wiltshire, R. J. E. & W. D. Jackson. 2003. Index of chromosome numbers of Tasmanian spermatophytes. Pap. & Proc. Roy. Soc. Tasmania 137: 39–53.

CCDB · book-ipcn66 — Turner1966b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type14 508 records

Wild obs. + sensor12 821

Museum / vouchered1 636

Cultivated / captive35

Other16

Origin

Native1 149

Range

Area of Occupancy AOO32 344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 8 006≤1 km 2 505≤10 km 507>10 km 129

11 147 georeferenced · 1 674 without coordinates

Open the mapobservation + sensor12 821

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 328≤1 km 426≤10 km 655>10 km 78

1 487 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence1 636

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy97% within 1 km

≤100 m 32≤1 km 2≤10 km 1

35 georeferenced

Open the mapnot free-living35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	363
Adelaide, AU	352
Museo Entomologico de Leonlocation not on record	232
Hobart, AU	144
Brisbane, AU	123
Mount Annan, AU	111
Armidale, AU	39
NSW Dept of Planning, Industry and Environmentlocation not on record	24
QVMAGlocation not on record	24
Kew, GB	23
Parkville, AU	15
Batemans Bay, AU	15
La Trobe Universitylocation not on record	14
John T. Waterhouse Herbariumlocation not on record	11
Wollongong, AU	10
Palmerston, AU	7
Auckland, NZ	5
Kensington, AU	3
Uppsala, SE	2
South Kensington, GB	2
Wellington, NZ	2
Davis, US	1
James Cook Townsvillelocation not on record	1
Christchurch, NZ	1
University of Stellenboschlocation not on record	1
Boise, US	1
AUAlocation not on record	1
Cambridge University Herbariumlocation not on record	1
EL PASO, US	1

29 institutions · 1 529 of 1 636 vouchered records shown · 107 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Stackhousia monogyna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stackhousia monogyna

At a glance

Sources9 archives

Size & morphology16

Life cycle & reproduction9

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type14 508 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 29 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type14 508 records