Stackhousia clementii

Domin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Stackhousia

At a glance

Occurrence records252

Data sources6

Biological traits25

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Stackhousia clementii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility252 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF252 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Stackhousia clementii is a species of plant in the family Celastraceae. The dense perennial herb typically grows to a height of 0.45 m and produces yellow-green-brown flowers. The species is found across western and central Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Fruit length2.65 mm

Fruit width3.5 mm

Leaf length15 mm

Leaf length max15 mm

Leaf width0.7 mm

Plant height0.45 m

Plant height max0.45 m

Life cycle & reproduction6

Dispersal typeanimal

Life formperennial or subshrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacitypartial_resprouting

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear narrowly_elliptical

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stackhousia clementii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU169128.1 ↗602 bpAustralia

ACGT

TCGAAACCTGGCCCGAACGGAACGATCGCGAACCGGTTGGAATAAACGTGCGGTGCGGCTGGGGTGCCCTAAGGGAGCCTCGACTGCAGC …

Stackhousia clementii voucher AD:97950516 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type252 records

Wild obs. + sensor57

Museum / vouchered195

Origin

Native46

Range

Area of Occupancy AOO728 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 32≤10 km 2

34 georeferenced · 23 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 48≤1 km 41≤10 km 91>10 km 7

187 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence195

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	72
Adelaide, AU	70
Kensington, AU	18
Canberra, AU	13
Brisbane, AU	6
Museo Entomologico de Leonlocation not on record	5
EL PASO, US	1
BGPAlocation not on record	1

8 institutions · 186 of 195 vouchered records shown · 9 without an institution code

09Environmental DNA1 detections

Where the DNA of Stackhousia clementii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)