Stachytarpheta jamaicensis
(L.) Vahl · speciesAt a glance
Occurrence records7 663
Data sources12
Biological traits36
DNA specimens37
eDNA detections27
Sources12 archives
Databases and archives Stachytarpheta jamaicensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 640 records↗
OBISOcean Biodiversity Information System23 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources36 traits
Chemical compositionLOTUS · NPASS11 compounds
Occurrence & distributionGBIF · OBIS7 663 records
Environmental DNA1 datasets · 5 countries27 detections
DNA & barcodingBOLD · NCBI37 specimens
01Narrative
Stachytarpheta jamaicensis, la Bleuète, Épi bleu, Herbe à chenilles, Herbe bleue, Queue de rat ou encore Véven bleu, est une espèce de plantes herbacées vivaces, ou de sous-arbrisseaux, de la famille des Verbenaceae, originaire d'Amérique.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology11
Fruit length5 mm
Fruit width2 mm
Leaf length60 mm
Leaf size2 700 mm²
Leaf width30 mm
Petiole length1.75 cm
Plant height1 m
⚠ sources differ — GIFT: 1 m · AusTraits: 1.2 m
Plant height max1 m
Seed mass0.82 mg
⚠ sources differ — AusTraits: 0.82 mg · GIFT: 2.36 mg
Seed mass max2.36 mg
Seed mass min2.36 mg
Life cycle & reproduction8
Deciduousnessevergreen
Dispersal typeself
⚠ sources differ — AusTraits: barochory · GIFT: zoochorous
Flowering timeyyyyyynnnnnn
Life formsubshrub
Life spanperennial
Pollination syndromebee
Raunkiær life formtherophyte
Resprouting capacityresprouts
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typemericarp
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: shrub · TRY: Herb
Habitat GIFTÁrea Antrópica, Palmeiral
Leaf compoundnesssimple
Leaf shapeelliptical oblong obovate
Succulenceno
Woodinesswoody
⚠ sources differ — TRY: woody · AusTraits: woody · GIFT: non-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition11 compounds
Compounds documented for Stachytarpheta jamaicensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Fatty alcohols2
Menthane monoterpenoids2
Labdane diterpenoids2
Bisabolane sesquiterpenoids1
Cinnamic acids and derivatives1
Documented compounds11 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2S,3S,4R,4aS,8aS)-3,4a,8,8-tetramethyl-4-[(2E)-3-methylpenta-2,4-dienyl]-2,4,5,6,7,8a-hexahydro-1H-naphthalene-2,3-diol | present | NPASS | |
| 1-Tritriacontanol | present | NPASS | |
| 6alpha-Hydroxynidorellol | present | NPASS | |
| [(3S,8S,9Z)-3-hydroxyheptadeca-1,9,16-trien-4,6-diyn-8-yl] acetate | present | NPASS | |
| CBNQQLLPVQBVAM-OAHLLOKOSA-N | present | NPASS | |
| Ipolamiide | present | LOTUS | |
| methyl (E)-2-methyl-5-[(4R)-4-propan-2-ylcyclohexa-1,5-dien-1-yl]pent-2-enoate | present | NPASS | |
| Methyl 2-methyl-5-(4-propan-2-ylphenyl)pent-2-enoate | present | NPASS | |
| Methyl nidorellaurinate | present | NPASS | |
| STCGEEFQLSTNRZ-ARXFIZTISA-N | present | NPASS |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stachytarpheta jamaicensis has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes6
GenBank sequences10
eDNA detections27
Countries5
The DNA barcodea real sequence read deposited for this species
GAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCACGCCCGCTCCCCGACA …
Stachytarpheta jamaicensis voucher CTU-CNS MT13 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL7★rbcLa★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
08Occurrence & distribution
Record type7 663 records
Wild obs. + sensor4 848
Museum / vouchered2 301
Cultivated / captive1
Other513
Origin
Native30
Introduced114
Range
Area of Occupancy AOO17 828 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 2 508≤1 km 429≤10 km 423>10 km 220
3 580 georeferenced · 1 268 without coordinates
Open the mapobservation + sensor4 848
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy73% within 1 km
≤100 m 531≤1 km 90≤10 km 163>10 km 62
846 georeferenced · 1 455 without coordinates
Open the institutions mapphysical evidence2 301
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions95 of 181 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 243 |
| Saint Louis, US | 202 |
| Brisbane, AU | 189 |
| Bronx, US | 95 |
| San Francisco de Campeche, MX | 89 |
| Sydney, AU | 82 |
| Mérida, MX | 57 |
| Miami, US | 54 |
| Kew, GB | 46 |
| University of Stellenboschlocation not on record | 45 |
| Mexico City, MX | 40 |
| Tampa, US | 36 |
| Taipei, TW | 33 |
| Smithfield, AU | 30 |
| Canberra, AU | 28 |
| Palmerston, AU | 27 |
| National Biodiversity Institute, Costa Ricalocation not on record | 25 |
| MeiseBGlocation not on record | 23 |
| Mount Annan, AU | 21 |
| Chicago, US | 20 |
| Taipei, TW | 20 |
| Tapachula, MX | 19 |
| St. Augustine, TT | 19 |
| Nishihara, JP | 18 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 17 |
| PBZTlocation not on record | 16 |
| Central China Normal Universitylocation not on record | 15 |
| Austin, US | 15 |
| Odawara, JP | 14 |
| Adelaide, AU | 14 |
| Plocation not on record | 13 |
| Museo Entomologico de Leonlocation not on record | 13 |
| Beijing, CN | 13 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 13 |
| Leiden University Medical Centerlocation not on record | 13 |
| TAIElocation not on record | 12 |
| Honolulu, US | 12 |
| Guangzhou, CN | 11 |
| Mérida, MX | 11 |
| Tsukuba, JP | 10 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 10 |
| Guilin, CN | 8 |
| BISHlocation not on record | 8 |
| Kunming, CN | 7 |
| Paris, FR | 7 |
| WAGlocation not on record | 7 |
| San José, CR | 7 |
| EL PASO, US | 7 |
| Taipei, TW | 6 |
| Glocation not on record | 6 |
| Tuxtla Gutiérrez, MX | 6 |
| Area de Conservacion Guanacastelocation not on record | 6 |
| Bloomington, US | 6 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 5 |
| Kensington, AU | 5 |
| Laboratorio de Ictiologialocation not on record | 5 |
| CJBGlocation not on record | 5 |
| Austin, US | 5 |
| Mexico City, MX | 5 |
| Hobart, AU | 5 |
| CASlocation not on record | 5 |
| Riverside, US | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| ASUlocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| Chapingo, MX | 4 |
| Nanjing, CN | 4 |
| Universidade Federal do Maranhãolocation not on record | 4 |
| University of Papua New Guinealocation not on record | 4 |
| James Cook Townsvillelocation not on record | 4 |
| TAFORI-LSRClocation not on record | 4 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| TNMlocation not on record | 3 |
| Sanda, JP | 3 |
| Nishihara, JP | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| Armidale, AU | 3 |
| Altos de Pipe, VE | 3 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 3 |
| UFOPlocation not on record | 3 |
| Guangzhou, CN | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| MAlocation not on record | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| Provincia di Livornolocation not on record | 3 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 3 |
| Shenzhen, CN | 3 |
| León, NI | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Auckland, NZ | 2 |
| Feira de Santana, BR | 2 |
| NHMJlocation not on record | 2 |
| Durban, ZA | 2 |
| Mexico City, MX | 2 |
| Berlin, DE | 2 |
| South Kensington, GB | 2 |
| Fukushima Universitylocation not on record | 2 |
| Guasave, MX | 2 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 2 |
| Llocation not on record | 2 |
| Tuscaloosa, US | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| Changsha, CN | 2 |
| UFBAlocation not on record | 2 |
| Stockholm, SE | 2 |
| Claremont, US | 2 |
| Conservatoire Botanique National de Mascarinlocation not on record | 2 |
| Christchurch, NZ | 2 |
| Seychelles National Herbariumlocation not on record | 2 |
| Tempe, US | 2 |
| MEXUlocation not on record | 2 |
| Cibinong, ID | 2 |
| LBVlocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Burlington, US | 2 |
| Bangkok, TH | 2 |
| BRLUlocation not on record | 2 |
| Xiamen, CN | 2 |
| UFMSlocation not on record | 1 |
| HEMlocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| Boise, US | 1 |
| Kagoshima, JP | 1 |
| Antiguo Cuscatlán, SV | 1 |
| WTUlocation not on record | 1 |
| Museo Athanasius Kircher di Romalocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| UEMAlocation not on record | 1 |
| Flagstaff, US | 1 |
| Whitehorse, CA | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Pullman, US | 1 |
| DSMlocation not on record | 1 |
| Long Beach, US | 1 |
| Montréal, CA | 1 |
| Richmond, US | 1 |
| Criciúma, BR | 1 |
| Montecillo, Texcoco, MX | 1 |
| Denver, US | 1 |
| Columbia, US | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Vancouver, CA | 1 |
| Zapopan, MX | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Uppsala, SE | 1 |
| UTPLlocation not on record | 1 |
| Nagano City, JP | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| Jinghong, CN | 1 |
| Wlocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| OTSlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Whitewater, US | 1 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| Centro de Biotecnologia e Quimica-CEBIQlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| California Academy of Scienceslocation not on record | 1 |
| Madison, US | 1 |
| Cambridge, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| BMlocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Fredericksburg, US | 1 |
| University of Santo Tomas Museumlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Chapel Hill, US | 1 |
| UNESClocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Fort Worth, US | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Philadelphia, US | 1 |
| Cruz das Almas, BR | 1 |
181 institutions · 2 022 of 2 301 vouchered records shown · 279 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA27 detections
Where the DNA of Stachytarpheta jamaicensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found27
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 27 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.4 °C 22.2–26.1
Seasonal swing summer↔winter2.50 °C
Max temp (day)27.7 °C 25.6–29.5
Min temp (night)22.6 °C 14.8–23.1
Precipitation288 mm/mo 114–350
Air humidity73.2 % 54.5–75.0
Moisture balance179 mm/mo 0.9–200
Vapour deficit867 Pa 717–1,153
Wind speed1.50 m/s 1.20–2.70
Cloud cover44.5 % 31.3–57.6
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.