Stachys sylvatica
speciesAt a glance
Occurrence records567 669
Data sources14
Biological traits57
DNA specimens37
eDNA detections22
Sources14 archives
Databases and archives Stachys sylvatica's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility567 668 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources57 traits
Chemical compositionLOTUS · NPASS26 compounds
Occurrence & distributionGBIF · PBDB567 669 records
Environmental DNA1 datasets · 6 countries22 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceCCDB · GoaT1.4 Gbp
Deep timePBDB1 fossils
01Narrative
L'Épiaire des bois, encore appelée Ortie puante, est une espèce de plantes à fleurs de la famille des Lamiacées. C'est une plante herbacée vivace originaire d'Eurasie. Les feuilles froissées dégagent une odeur très désagréable évoluant vers un arôme proche du cèpe.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology21
Fruit length2 mm
Fruit width1 mm
Leaf length70 mm
Leaf length max145 mm
Leaf mass59.95 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 2 140 mm² · GIFT: 2 140 mm²
Leaf width43.5 mm
Petiole length4.75 cm
Plant height0.646 m
⚠ sources differ — GIFT: 0.646 m · AusTraits: 1.2 m · LEDA: 0.525 m · TRY: 0.625 m
Plant height generative0.676 m
Plant height max1.2 m
Plant height min0.3 m
Seed length1.95 mm
Seed length max2 mm
Seed length min2 mm
Seed mass1.41 mg
⚠ sources differ — TRY: 1.41 mg · LEDA: 1.42 mg · GIFT: 1.2 mg
Seed mass max1 mg
Seed mass min1 mg
Seed volume1.3 mm³
Seed volume max1.3 mm³
Seed volume min1.3 mm³
Life cycle & reproduction13
Deciduousnessdeciduous
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: autochorous
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number200
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typemericarp
Growth formherb
Habitat GIFTforest, forest edges, shrubberies
Leaf shapeovate widely_ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio12.69 g/g
Leaf c453 mg/g
Leaf dry-matter content (LDMC)165 mg/g
⚠ sources differ — TRY: 165 mg/g · LEDA: 207 mg/g
Leaf n29.11 mg/g
Leaf p3.1 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)52.46 mm²/mg
⚠ sources differ — TRY: 52.46 mm²/mg · LEDA: 44.7 mm²/mg · GIFT: 41.8 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition26 compounds
Compounds documented for Stachys sylvatica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Dibenzylbutyrolactone lignans6
Unsaturated fatty acids4
Cadinane sesquiterpenoids2
Flavones2
Iridoids monoterpenoids2
Documented compounds26 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Arctigenin | present | NPASS | |
| (-)-Arctiin | present | NPASS | |
| (-)-Matairesinol | present | NPASS | |
| (1S,3R,4S,5S,9S,10R,13R)-3-acetyloxy-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid | present | LOTUS | |
| (3E,4R)-4-[(3,4-dimethoxyphenyl)methyl]-3-[(4-hydroxy-3-methoxyphenyl)methylidene]oxolan-2-one | present | NPASS | |
| 1,6-Dimethyl-4-(propan-2-yl)-1,2,3,4,4a,5-hexahydronaphthalene | present | LOTUS | |
| 3,8-dimethyl-5-propan-2-yl-4,4a,5,6,7,8-hexahydro-3H-naphthalen-2-one | present | LOTUS | |
| 7-Methyl-1-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-4a,5,7-triol | present | LOTUS | |
| [(2R,3S,4S,5S,6S)-3,4,5-trihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxyoxan-2-yl]methyl (E)-3-(4-hydroxyphenyl)prop-2-enoate | present | LOTUS | |
| [3,4,5-Trihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxyoxan-2-yl]methyl 3-(4-hydroxyphenyl)prop-2-enoate | present | LOTUS |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stachys sylvatica has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes6
GenBank sequences10
eDNA detections22
Countries9
The DNA barcodea real sequence read deposited for this species
CGCCGCCCGCGACGTAGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGG …
Stachys sylvatica voucher CXK750, s.n. small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL8★rbcLa★ITS1★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Stachys sylvatica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 378 980 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Stachys sylvatica1.38 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 64 n = 32
Ploidy2× diploid · measured
Chromosome records48–662n range64median64mode42records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6417×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +5
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Murín A. & Májovský J., 1979: Karyological Study of slovakian flora I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 27: 127-133.
CCDB · slov-fl — Mičieta K., 1981: Zytotaxonomische Probleme einiger Pflanzensippen des Javorníky - Gebirges. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 28: 95-104.
CCDB · slov-fl — Migra V., 1982: Zytotaxonomische Probleme ausgewählter Taxa der Flora des Babia Hora - Bergmassivs (Gebirge Západné Beskydy) I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 29: 87-95.
CCDB · brit-fl — Morton, J.K. Watsonia 9: 239-246 (1973)
CCDB · brit-fl — Wilcock, C.C., Jones, B.M.G. Watsonia 10: 139-147 (1974)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3461
CCDB · ipcn-api-dl — Nikolov, N. A. 1991. Chromosome numbers of Bulgarian angiosperms from North Pirin Mountain: Reserve "Bajuvi Dupki--D|3zind|3zirica". Fitologija 41: 70–75.
CCDB · ipcn-api-dl — AYDIN, A. 1978. In IOPB chromosome number reports LXI. Taxon 27: 375–392.
CCDB · book-ipcn75-78 — Aydin 1978
CCDB · book-ipcn73-74 — MORTON, J.K. 1973. A cytological study of the British Labiatae excluding Mentha) (Lamiaceae). Watsonia 9: 239-246.
CCDB · CromoCat 2015 — Aydin, A. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 375-376.
CCDB · CromoCat 2015 — Koeva-Todorovska, J. T. (1988). Kariologicno i polenomorfologicno izsledvane na vidovete ot rod Stachys L. v Balgarija. In: 100 ann. acad. N. Stojanov : 138-151.
CCDB · CromoCat 2015 — Nikolov, N.A. (1991). Chromosome numbers of Bulgarian Angiosperms from North Pirin mountain Fitologija 41: 70-75.
2n 6617×CCDB · fl-europaea · CCDB · poland · CCDB · ipcn-api-dl +2
CCDB · fl-europaea — Polya, 1950
CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.
CCDB · ipcn-api-dl — Strid, A. 1983. In IOPB chromosome number reports LXXVIII. Taxon 32: 138–140.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Mulligan, G. A. & D. B. Munro. 1989. Taxonomy of species of North American Stachys (Labiatae) found north of Mexico. Naturaliste Canad. 116: 35–51.
CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Micieta, K. 1981. Zytotaxonomische probleme einiger Pflanzensippen des Javorniky-Gebirges. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 28: 95–104.
CCDB · ipcn-api-dl — Murin, A. & J. Majovsky. 1979. Karyological study of Slovakian flora I. Acta Fac. Rerum Nat. Univ. Comeninae, Bot. 27: 127–133.
CCDB · ipcn-api-dl — Pogan, E., H. Wcislow & A. Jankun. 1980. Further studies in chromosome numbers of Polish Angiosperms Part XlIl. Acta Biol. Cracov., Ser. Bot. 22: 37–69.
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Koeva-Todorovska, J. T. (1988). Kariologicno i polenomorfologicno izsledvane na vidovete ot rod Stachys L. v Balgarija. In: 100 ann. acad. N. Stojanov : 138-151.
CCDB · CromoCat 2015 — Loon van, J. C. & van Setten, A. K. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 589-592.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Nikolov, N.A. (1991). Chromosome numbers of Bulgarian Angiosperms from North Pirin mountain Fitologija 41: 70-75.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1983a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVIII]. Taxon 32(1): 138-140.
2n 486×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žhurn. (Moscow & Leningrad) 79(2): 135–139.
CCDB · book-ipcn75-78 — 64
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · CromoCat 2015 — Stepanov, N. V. (1994a). Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žurn. 79(2): 135-139.
2n 542×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Migra, V. 1982. Zytotaxonomische probleme ausgewahlter taxa der flora des Babia Hora-Bergmassivs (Gebirge Zapane Beskydy) I. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 29: 87–95.
CCDB · CromoCat 2015 — Migra, V. (1982). Zytotaxonomische probleme ausgewahlter taxa der flora des Babia Hora-Bergmassivs (Gebirge Zapane Beskydy) I Acta Facultatis Rerum Naturalium Universitatis Comenianae, Botanica 29: 87-95
2n 331×CCDB · ita-fl
CCDB · ita-fl — ROMANO S., OTTONELLO D., MARCEN C. - 1995 (1994). Numeri Cromosomici per la Flora Italiana.. Inform. Bot. Ital. , 26(2-3): 191-199.
n 321×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — GILL, L.S. 1970. Cytological observations on West-Himalayan Labiatae: Tribe Stachydeae. Phyton (Buenos Aires) 27: 177-184.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time3.6–2.58 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range3.6–2.58 Ma Pliocene
Dated fossil finds1
StatusNot recorded since 2.58 Ma
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Stachys sylvatica. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
08Occurrence & distribution
Record type567 669 records
Wild obs. + sensor551 975
Museum / vouchered12 531
Cultivated / captive479
Fossil3
Other2 681
Origin
Native42 212
Introduced17
Range
Area of Occupancy AOO533 016 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy46% within 1 km
≤100 m 100 729≤1 km 117 354≤10 km 251 717>10 km 3 569
473 369 georeferenced · 78 606 without coordinates
Open the mapobservation + sensor551 975
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 604≤1 km 2 532≤10 km 5 709>10 km 210
9 055 georeferenced · 3 476 without coordinates
Open the institutions mapphysical evidence12 531
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 6>10 km 14
20 georeferenced · 459 without coordinates
Open the mapnot free-living479
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions84 of 173 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 867 |
| BFLlocation not on record | 525 |
| Olocation not on record | 467 |
| Moscow State Universitylocation not on record | 365 |
| LDlocation not on record | 351 |
| BIO-UNIPIlocation not on record | 296 |
| Zürich, CH | 266 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 253 |
| Salzburg, AT | 248 |
| Trondheim, NO | 207 |
| MeiseBGlocation not on record | 199 |
| Zürich, CH | 190 |
| Kuopio, FI | 169 |
| Oskarshamn, SE | 138 |
| Tartu, EE | 124 |
| Bergen, NO | 121 |
| KMNlocation not on record | 115 |
| TROMlocation not on record | 93 |
| Oulu, FI | 80 |
| Bern, CH | 74 |
| Turku, FI | 71 |
| SLU Artdatabankenlocation not on record | 65 |
| BRNUlocation not on record | 60 |
| Görlitz, DE | 58 |
| Provincia di Livornolocation not on record | 53 |
| Tallinn, EE | 53 |
| Uppsala, SE | 47 |
| Entomological Society of Latvialocation not on record | 46 |
| MAlocation not on record | 44 |
| South Kensington, GB | 43 |
| Auckland, NZ | 40 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 40 |
| BDBClocation not on record | 39 |
| Jyväskylä, FI | 37 |
| Mlocation not on record | 36 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 34 |
| TUR-Alocation not on record | 33 |
| Berlin, DE | 31 |
| València, ES | 30 |
| Vitoria, ES | 29 |
| Barcelona, ES | 26 |
| Wlocation not on record | 25 |
| WNNUlocation not on record | 25 |
| Uniwersytet Śląski w Katowicachlocation not on record | 23 |
| Christchurch, NZ | 23 |
| Wellington, NZ | 23 |
| BClocation not on record | 22 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 18 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 18 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 17 |
| GJOlocation not on record | 17 |
| GZUlocation not on record | 16 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| Uniwersytet Warszawskilocation not on record | 15 |
| Rotorua, NZ | 13 |
| Salamanca, ES | 13 |
| Tula State Universitylocation not on record | 13 |
| Porrentruy, CH | 13 |
| Urumqi, CN | 13 |
| Karlsruhe, DE | 12 |
| DBF-NHMDlocation not on record | 12 |
| Frankfurt am Main | 12 |
| Stockholm, SE | 11 |
| Helsinki, FI | 11 |
| CJBGlocation not on record | 10 |
| Yangling, CN | 10 |
| Porvoo, FI | 10 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 9 |
| Hobart, AU | 9 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 9 |
| Glarus, CH | 8 |
| Bronx, US | 8 |
| IB FRC Komi SC UB RASlocation not on record | 8 |
| Winterthur, CH | 8 |
| Museo Entomologico de Leonlocation not on record | 8 |
| Museo Achille Folettolocation not on record | 7 |
| Uniwersytet Opolskilocation not on record | 7 |
| College of the Atlantic, Museumlocation not on record | 7 |
| Tilburg, NL | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Madrid, ES | 7 |
| Forssa, FI | 7 |
| PrivatHerblocation not on record | 7 |
| Philadelphia, US | 6 |
| Kew, GB | 6 |
| Dresden, DE | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Uniwersytet w Białymstokulocation not on record | 5 |
| OLAlocation not on record | 5 |
| Beijing, CN | 5 |
| Frauenfeld, CH | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| UGentlocation not on record | 4 |
| nbflocation not on record | 4 |
| Bourges, FR | 3 |
| Granada, ES | 3 |
| Pamplona, ES | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Fulda, DE | 3 |
| Paris, FR | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Bloomington, US | 3 |
| ZRC-SAZUlocation not on record | 3 |
| Podgorica, ME | 3 |
| Jaén, ES | 3 |
| Badajoz, ES | 2 |
| Palmerston North, NZ | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Oswego, US | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Namur, BE | 2 |
| Philadelphia, US | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Columbia, US | 2 |
| BSBIlocation not on record | 2 |
| Sion, CH | 2 |
| Mount Annan, AU | 2 |
| Salvador, BR | 2 |
| Canberra, AU | 2 |
| PRClocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| FLADlocation not on record | 2 |
| Alicante, ES | 2 |
| Chongqing Museumlocation not on record | 2 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 2 |
| Flagstaff, US | 1 |
| Xiamen, CN | 1 |
| Acadia Universitylocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Nijmegen, NL | 1 |
| H-Schuhwlocation not on record | 1 |
| GMBAlocation not on record | 1 |
| LUXEMBOURG, LU | 1 |
| Clemson, US | 1 |
| AUAlocation not on record | 1 |
| Gijón, ES | 1 |
| University of Hamburglocation not on record | 1 |
| Edinburgh, GB | 1 |
| Santiago de Compostela, ES | 1 |
| PUC-RSlocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| WTUlocation not on record | 1 |
| Davenport, US | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Taipei, TW | 1 |
| Saint Louis, US | 1 |
| Rovaniemi, FI | 1 |
| Durham, US | 1 |
| Tuscaloosa, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| H-AkrKGlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Xining, CN | 1 |
| Pechora-Ilych Nature Reservelocation not on record | 1 |
| Montréal, CA | 1 |
| CICYTEXlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Monastir, TN | 1 |
| Macomb, US | 1 |
| SZUlocation not on record | 1 |
| Pamplona, ES | 1 |
173 institutions · 11 824 of 12 531 vouchered records shown · 561 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Stachys sylvatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map6 countries0
at edge of wood next to path
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.8 °C 5.80–17.9
Seasonal swing summer↔winter14.2 °C
Max temp (day)17.2 °C 8.40–21.3
Min temp (night)12.0 °C 3.70–14.8
Precipitation82.1 mm/mo 63.6–93.0
Air humidity62.8 % 60.3–64.8
Moisture balance-26.6 mm/mo -53.1–41.1
Vapour deficit612 Pa 385–812
Wind speed4.40 m/s 2.90–5.10
Cloud cover51.2 % 35.1–60.5
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.