Stachys rugosa

Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Stachys

At a glance

Occurrence records308

Data sources5

Biological traits13

DNA specimens1

eDNA detections1

Sources5 archives

Databases and archives Stachys rugosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility308 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF308 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max1.2 m

Plant height min0.3 m

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 900 m

Elevation min180 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stachys rugosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes4

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV090955.1 ↗610 bpSouth Africa · 2022

ACGT

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAAGCAGACCGCGAACACGTTCACAAACAACCCCGGCGCGCGGAGCGGGGGCGACC …

Stachys rugosa voucher 052A small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type308 records

Wild obs. + sensor121

Museum / vouchered187

Range

Area of Occupancy AOO832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 92≤1 km 13≤10 km 2>10 km 4

111 georeferenced · 10 without coordinates

Open the mapobservation + sensor121

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 11>10 km 7

19 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence187

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	146
Zürich, CH	19
Cape Town, ZA	6
Zürich, CH	2
Durban, ZA	2
Xiamen, CN	2
South African Environmental Observations Networklocation not on record	1
Moscow State Universitylocation not on record	1
Saint Louis, US	1

9 institutions · 180 of 187 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Stachys rugosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.5 °C 10.5–10.5

Seasonal swing summer↔winter12.5 °C

Max temp (day)16.6 °C

Min temp (night)5.20 °C

Precipitation75.5 mm/mo

Air humidity53.2 %

Moisture balance5.20 mm/mo

Vapour deficit592 Pa

Wind speed4.40 m/s

Cloud cover5.00 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)