Stachys recta
speciesAt a glance
Occurrence records115 821
Data sources12
Biological traits41
DNA specimens8
eDNA detections4
Sources12 archives
Databases and archives Stachys recta's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility115 821 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics8 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Chemical compositionLOTUS · NPASS45 compounds
Occurrence & distributionGBIF115 821 records
Environmental DNA1 datasets · 1 countries4 detections
DNA & barcodingBOLD · NCBI8 specimens
Genome at a glanceCCDB · GoaT846 Mbp
01Narrative
L'Épiaire droite est une espèce de plantes à fleurs de la famille des Lamiacées. C'est une plante herbacée vivace originaire du sud de l'Europe.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass25.27 mg
Leaf size2 620 mm²
⚠ sources differ — TRY: 2 620 mm² · LEDA: 740 mm² · GIFT: 740 mm²
Plant height0.325 m
⚠ sources differ — GIFT: 0.325 m · LEDA: 0.325 m · TRY: 0.573 m
Plant height generative0.4 m
Plant height max1 m
Plant height min0.2 m
Seed length2 mm
Seed mass1.42 mg
⚠ sources differ — TRY: 1.42 mg · LEDA: 1.75 mg · GIFT: 1.51 mg
Seed mass max1.63 mg
Seed mass min1.02 mg
Life cycle & reproduction12
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeanimal
Flowering endSep
Flowering startJun
Life formperennial
Life spanannual
⚠ sources differ — TRY: annual · GIFT: perennial
Lifespan years9 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Seed number309
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTmountains, steppe, stony places
Mycorrhiza type0.0000000632
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio16.28 g/g
Leaf c459 mg/g
Leaf dry-matter content (LDMC)209 mg/g
Leaf n28.19 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)33.58 mm²/mg
⚠ sources differ — TRY: 33.58 mm²/mg · LEDA: 28.54 mm²/mg · GIFT: 28.54 mm²/mg
Wood density160 mg/cm³
Other traits2
Diaspore typemericarp
Shoot orientationascending
03Chemical composition45 compounds
Compounds documented for Stachys recta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Anthraquinones and anthrones15
Iridoids monoterpenoids7
Flavones4
Cadinane sesquiterpenoids2
Acyclic monoterpenoids2
Documented compounds45 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Caryophyllene | present | LOTUS | |
| (2S,3R,4S,5S,6R)-2-[[(1S,4aS,5R,7S,7aR)-4a,5-dihydroxy-7-methyl-5,6,7,7a-tetrahydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (3R,6E)-Nerolidol | present | LOTUS | |
| (R)-1-Octen-3-ol | present | LOTUS | |
| 1,3,5-Trihydroxy-2-(Methoxymethyl)Anthracene-9,10-Dione | present | NPASS | |
| 1,3,5-Trihydroxy-9,10-dioxoanthracene-2-carbaldehyde | present | NPASS | |
| 1,6-Dimethyl-4-(propan-2-yl)-1,2,3,4,4a,5-hexahydronaphthalene | present | LOTUS | |
| 1-Hydroxy-2-(hydroxymethyl)-9,10-anthracenedione | present | NPASS | |
| 2,5-Dihydroxy-1-methoxy-anthraquinone | present | NPASS | |
| 2-(Ethoxymethyl)-1,3,5-trihydroxyanthracene-9,10-dione | present | NPASS |
05DNA & barcoding8 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stachys recta has left across the world's sequence archives.
At a glance
DNA specimens8
Marker genes4
GenBank sequences10
eDNA detections4
Countries4
The DNA barcodea real sequence read deposited for this species
TACAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGCCCAAACCCGAATCCACTGCCGATGCA …
Stachys recta voucher HAVR-2017-7 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Stachys recta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size845 970 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Stachys recta0.85 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 34 n = 17
Ploidy4× tetraploid · measured
Chromosome records32–342n range34median34mode64records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3461×CCDB · ita-fl · CCDB · slov-fl · CCDB · fl-europaea +6
CCDB · ita-fl — CUSMA VELARI T., LAUSI D. - 1980. Indagini cariologiche in Stachys recta L., S. labiosa Bertol., S. subcrenata Vis., S. fragilis Vis.. Stud. Geobot. , 1(1): 149-155.
CCDB · ita-fl — BALTISBERGER M. - 1990 (1988). Numeri cromosomici per la flora italiana: 1167-1184.. Inform. Bot. Ital. , 20(2-3): 627-636.
CCDB · ita-fl — BALTISBERGER M. - 1990. Zytologische Untersuchungen an einigen Arten aus Italien.. Archivio Botanico Italiano , 66(3/4): 153-165.
CCDB · ita-fl — KIEFT B., LOON J.C. - 1978. IOPB chromosome number reports LXII.. Taxon , 27(5/6): 524-525.
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · ita-fl — ARRIGONI P.V., GIANNERINI M., MORI B. - 1980. Numeri cromosomici per la flora italiana:714-721.. Inform. Bot. Ital. , 12(2): 137-143..
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Hallonová A., 1982: Floristické pomery horskej skupiny Skalky (Strážovské vrchy). - Stredné Slovensko 2: 308-323.
CCDB · fl-europaea — Majovsky et al.
CCDB · fl-europaea — Favarger, 1959a
CCDB · poland — Pogan E., Czapik R., Jankun A., Kuta E. et al. 1982 a. Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov. Ser. Bot. 24, 91-126.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK, A. Jankun & E. Kuta. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 113–126.
CCDB · ipcn-api-dl — Baltisberger, M. 1990. Chromosomenzahlen einiger Pflanzen aus Jugoslawien. Candollea 45: 439–446.
CCDB · ipcn-api-dl — Lippert, W. & G. R. Heubl. 1989. Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73–83.
CCDB · ipcn-api-dl — Baltisberger, M. 1990. Zytologische Untersuchungen an einigen Arten aus Italien. Arch. Bot. Ital. 66: 153–165.
CCDB · ipcn-api-dl — Baltisberger, M. & A. Lenherr. 1984. Neue Chromosomenzahlen aus der Gruppe der Stachys recta L. und anderen, verwandten Artengruppen. Ber. Geobot. Inst. ETH Stiftung Rübel 51: 39–62.
CCDB · ipcn-api-dl — Baltisberger, M. 1988. Numeri cromosomici per la flora Italiana: 1167--1184. Inform. Bot. Ital. 20: 627–636.
CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Cusma Velari, T. & D. Lausi. 1980. Indagini cariologiche in Stachys recta L., S. labiosa Bertol., S. subcrenata Vis., S. fragilis Vis. Stud. Geobot. 1(1): 149–155.
CCDB · ipcn-api-dl — KLIPHUIS, E. & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28:398–400.
CCDB · ipcn-api-dl — KOEVA-TODOROVSKA, J. 1978. Pontostachys---A new section of the genus Stachys L. Phytologija (Sofia) 10: 33–40.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Buttler, K. P. 1983. Chromosomenzahlen von Gefässpflanzen aus Hessen (und dem angrenzenden Bayern). 1. Folge. Hess. Florist. Briefe. 32: 23–26ý.
CCDB · ipcn-api-dl — Arrigoni, P. V., M. Giannerini & B. MORI. 1980. Numeri cromosomici per la Flora Italiana: 714-721. Inform. Bot. Ital. 12: 137–143.
CCDB · ipcn-api-dl — Baltisberger, M. 1991. Chromosomenzahlen einiger Labiaten aus Albanien. Ber. Geobot. Inst. ETH Stiftung Rübel 57: 165–181.
CCDB · ipcn-api-dl — Baltisberger, M. 1987. Chromosomenzahlen einiger Pflanzen aus Albanien. Ber. Geobot. Inst. ETH Stiftung Rübel 53: 47–63.
CCDB · ipcn-api-dl — Baltisberger. 2006. Cytological investigations on Bulgarian phanerogams. Willdenowia 36(Special Issue): 205–216.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn75-78 — Koeva-Todorovska 1978
CCDB · book-ipcn75-78 — Kieft & Loon 1978
CCDB · book-ipcn75-78 — Aydin 1978
CCDB · CromoCat 2015 — Koeva-Todorovska, J. T. (1978). Pontostachys nova sekcija za rod Stachys L. Fitologija 10: 33-40.
CCDB · CromoCat 2015 — Koeva-Todorovska, J. T. (1988). Kariologicno i polenomorfologicno izsledvane na vidovete ot rod Stachys L. v Balgarija. In: 100 ann. acad. N. Stojanov : 138-151.
CCDB · CromoCat 2015 — Loon van, J. C. & van Setten, A. K. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 589-592.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Kieft, B. & van Loon, J. C. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 524-525.
CCDB · CromoCat 2015 — Kliphuis, E. & Wieffering, J. H. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 398-400.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 583-587.
+2 more references
2n 323×GoaT · Kew Plant DNA C-values Database · CCDB · kew · CCDB · CromoCat 2015
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213
CCDB · CromoCat 2015 — Siljak-Yakovlev, S., Pustahija, F., Šoli?, E.M., Boguni?, F., Muratovi?, E., Baši?, N., Catrice, O. & S. C. Brown. (2010). Towards a Genome Size and Chromosome Number Database of Balkan Flora: C-Values in 343 Taxa with Novel Values for 242 Advanced Scienc
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type115 821 records
Wild obs. + sensor111 325
Museum / vouchered3 276
Cultivated / captive9
Other1 211
Origin
Native71
Introduced15
Range
Area of Occupancy AOO106 080 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy25% within 1 km
≤100 m 14 856≤1 km 5 614≤10 km 59 587>10 km 1 098
81 155 georeferenced · 30 170 without coordinates
Open the mapobservation + sensor111 325
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 288≤1 km 511≤10 km 959>10 km 64
1 822 georeferenced · 1 454 without coordinates
Open the institutions mapphysical evidence3 276
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 8 without coordinates
Open the mapnot free-living9
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions44 of 105 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 815 |
| Zürich, CH | 317 |
| Moscow State Universitylocation not on record | 299 |
| Zürich, CH | 264 |
| MeiseBGlocation not on record | 84 |
| BRNUlocation not on record | 77 |
| Adam Mickiewicz University in Poznańlocation not on record | 76 |
| València, ES | 65 |
| BFLlocation not on record | 57 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 48 |
| BIO-UNIPIlocation not on record | 46 |
| Salzburg, AT | 43 |
| BDBClocation not on record | 41 |
| Berlin, DE | 32 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 32 |
| Wlocation not on record | 31 |
| MAlocation not on record | 29 |
| Mlocation not on record | 27 |
| Barcelona, ES | 27 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 27 |
| LDlocation not on record | 27 |
| GZUlocation not on record | 26 |
| Provincia di Livornolocation not on record | 25 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 25 |
| BClocation not on record | 22 |
| Oskarshamn, SE | 16 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 16 |
| Görlitz, DE | 15 |
| Pamplona, ES | 14 |
| LfUlocation not on record | 14 |
| GJOlocation not on record | 14 |
| Entomological Society of Latvialocation not on record | 11 |
| College of the Atlantic, Museumlocation not on record | 10 |
| Uniwersytet Śląski w Katowicachlocation not on record | 10 |
| Olocation not on record | 10 |
| Salamanca, ES | 8 |
| Frankfurt am Main | 7 |
| Dresden, DE | 6 |
| Museo Achille Folettolocation not on record | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 6 |
| Karlsruhe, DE | 6 |
| Alicante, ES | 5 |
| Samara National Research Universitylocation not on record | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Uniwersytet Warszawskilocation not on record | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Madrid, ES | 4 |
| Bourges, FR | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| SZUlocation not on record | 3 |
| Granada, ES | 3 |
| Tula State Universitylocation not on record | 3 |
| SLU Artdatabankenlocation not on record | 3 |
| Monastir, TN | 3 |
| Pamplona, ES | 3 |
| Glarus, CH | 3 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| Beijing, CN | 3 |
| Saint Louis, US | 2 |
| CICYTEXlocation not on record | 2 |
| Trondheim, NO | 2 |
| Fulda, DE | 2 |
| Christchurch, NZ | 2 |
| CJBGlocation not on record | 2 |
| Taipei, TW | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| JBCLMlocation not on record | 2 |
| Porrentruy, CH | 2 |
| Sion, CH | 1 |
| Durham, US | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| FLADlocation not on record | 1 |
| Universite de Montpellierlocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Columbia, US | 1 |
| Dhaka, BD | 1 |
| Jaén, ES | 1 |
| H-Schuhwlocation not on record | 1 |
| Xiamen, CN | 1 |
| Vitoria, ES | 1 |
| BGBMlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Banyoles, ES | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Gijón, ES | 1 |
| Paris, FR | 1 |
| H-AkrKGlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| PRClocation not on record | 1 |
| Macomb, US | 1 |
| Sevilla, ES | 1 |
| Boise, US | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Wellington, NZ | 1 |
| H-Hohlalocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| KMNlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| University of Stellenboschlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
105 institutions · 2 857 of 3 276 vouchered records shown · 382 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA4 detections
Where the DNA of Stachys recta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map1 country0
Non coniferous evergreen forests
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.1 °C 21.1–21.1
Seasonal swing summer↔winter17.2 °C
Max temp (day)25.8 °C
Min temp (night)15.2 °C
Precipitation40.1 mm/mo
Air humidity53.9 %
Moisture balance-122 mm/mo
Vapour deficit1,155 Pa
Wind speed2.90 m/s
Cloud cover39.2 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.