Stachys peruviana

Dombey ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Stachys

At a glance

Occurrence records28

Data sources7

Biological traits7

DNA specimens6

eDNA detections2

Sources7 archives

Databases and archives Stachys peruviana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Stachys peruviana là một loài thực vật có hoa trong họ Hoa môi. Loài này được Dombey ex Benth. miêu tả khoa học đầu tiên năm 1834.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stachys peruviana has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ412510.1 ↗258 bpPeru

ACGT

GCGGCCGGCCCAAACCCGAATCCGCCGTGACGGAGTCGCGACCAGTGGTGGTTGAACACTCAACTGGCGCTGTCGCGCACCAAGCGCCGT …

Stachys peruviana isolate Peru170220a internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type28 records

Museum / vouchered28

Range

Area of Occupancy AOO76 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 28 records without

Open the institutions mapphysical evidence28

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	12
Kew, GB	5
Chicago, US	5
Cusco, PE	2
Herbarium of South China Botanical Gardenlocation not on record	2
Universiti Sains Malaysialocation not on record	1
Zürich, CH	1

7 institutions · 28 of 28 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Stachys peruviana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 16.5–16.8

Seasonal swing summer↔winter4.90 °C

Max temp (day)18.8 °C

Min temp (night)15.0 °C 14.8–15.2

Precipitation6.60 mm/mo 6.20–7.00

Air humidity63.4 % 63.1–63.7

Moisture balance-139 mm/mo -139–-138

Vapour deficit692 Pa 691–693

Wind speed2.80 m/s 1.50–4.10

Cloud cover57.7 % 55.0–60.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)