Stachys arvensis
(L.) L. · speciesAt a glance
Occurrence records49 756
Data sources12
Biological traits59
DNA specimens21
eDNA detections12
Sources12 archives
Databases and archives Stachys arvensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility49 747 records↗
OBISOcean Biodiversity Information System9 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics21 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources59 traits
Occurrence & distributionGBIF · OBIS49 756 records
Environmental DNA1 datasets · 6 countries12 detections
DNA & barcodingBOLD · NCBI21 specimens
Genome at a glanceCCDB · GIFT · GoaT460 Mbp
01Narrative
La stregona minore è una piccola pianta erbacea dai fiori labiati appartenente alla famiglia delle Lamiacee.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology18
Fruit length13.5 mm
⚠ sources differ — AusTraits: 13.5 mm · GIFT: 2 mm
Fruit length max2 mm
Leaf length25 mm
Leaf length max50 mm
Leaf length min10 mm
Leaf mass7.31 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 218 mm² · GIFT: 217 mm²
Leaf width20 mm
⚠ sources differ — AusTraits: 20 mm · GIFT: 16 mm
Leaf width max32 mm
Leaf width min6 mm
Petiole length1.5 cm
Plant height0.159 m
⚠ sources differ — GIFT: 0.159 m · AusTraits: 0.325 m · LEDA: 0.175 m · TRY: 0.189 m
Plant height generative0.2 m
Plant height max0.6 m
Plant height min0.06 m
Seed mass0.729 mg
Seed mass max0.8 mg
Seed mass min0.65 mg
Life cycle & reproduction19
Deciduousnesssemi-evergreen
⚠ sources differ — TRY: semi-evergreen · GIFT: deciduous
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flower colourpink
Flower length max8 mm
Flower length min6 mm
Flowering endOct
Flowering startJul
Flowering timennnnnnnnyyyn
Life formannual
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Reproductive maturity0.442 years
Resprouting capacityfire_killed
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit typemericarp
Growth formherb
Habitat GIFTÁrea Antrópica, Campo de Altitude, Campo Limpo, Floresta Ombrófila (= Floresta Pluvial)
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapewidely_ovate
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)171 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.75
Specific leaf area (SLA)30.13 mm²/mg
Other traits2
Diaspore typemericarp
Seeds per fruit101-1000
05DNA & barcoding21 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stachys arvensis has left across the world's sequence archives.
At a glance
DNA specimens21
Marker genes6
GenBank sequences10
eDNA detections12
Countries8
The DNA barcodea real sequence read deposited for this species
GTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCA …
Stachys arvensis isolate Peru170472 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Stachys arvensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size459 660 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Stachys arvensis0.46 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Ploidydiploid inferred
Chromosome records10–202n range10median10mode28records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1023×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · iapt +11
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — BALTISBERGER M. - 1990 (1988). Numeri cromosomici per la flora italiana: 1167-1184.. Inform. Bot. Ital. , 20(2-3): 627-636.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · brit-fl — Morton, J.K. Watsonia 9: 239-246 (1973)
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · iber-fl — Contribution a l'tude citotaxonomique des spermatophyta du Portugal. XVIII. Lamiaceae Fernandes, A. & M. T. Leitao.Mem. Soc. Brot.27: 27-75(1985).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3466
CCDB · fl-europaea — Strid, 1965
CCDB · book-ipcn65 — Strid 1965a
CCDB · ipcn-api-dl — Baltisberger, M., W. Huber & B. Merz. 1990. Zytologische Untersuchungen an einigen Pflanzen von den Kanarischen Inseln. Ber. Geobot. Inst. ETH Stiftung Rübel 56: 142–149.
CCDB · ipcn-api-dl — Mulligan, G. A. & D. B. Munro. 1989. Taxonomy of species of North American Stachys (Labiatae) found north of Mexico. Naturaliste Canad. 116: 35–51.
CCDB · ipcn-api-dl — Baltisberger, M. 1988. Numeri cromosomici per la flora Italiana: 1167--1184. Inform. Bot. Ital. 20: 627–636.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Fernandes, A. & M. T. Leitão. 1984. Contribution à l'étude cytotaxinomique des Spermatophyta du Portugal XVIII---Lamiaceae. Mem. Soc. Brot. 27: 27–75.
CCDB · book-northern-plants — Lang 1940, Wulff 1939 b.
CCDB · book-ipcn73-74 — MORTON, J.K. 1973. A cytological study of the British Labiatae excluding Mentha) (Lamiaceae). Watsonia 9: 239-246.
CCDB · book-atlas-flowering-plants — Lang 1940
CCDB · CromoCat 2015 — Lang, A. (1940). Untersuchungen über einige verwandtschafts und abstammungs fragen in der gattung Stachys L. auf cytogenetischer grundlage. Biblioth. Bot. 118: 1-94.
CCDB · CromoCat 2015 — Morton, J. K. (1973). A cytological study of the British Labiatae (excluding Mentha). Watsonia 9: 239-246.
CCDB · CromoCat 2015 — Wulff, H. D. (1939b). Die pollenentwicklung der Juncaceen nebst einer auswertung der embryologischen befunde hinsichtlich einer verwandtschaftzwischen den Juncaceen und Cyperaceen. Jahrb. Wiss. Bot. 87: 533-557.
CCDB · CromoCat 2015 — Baltisberger, M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-889
CCDB · CromoCat 2015 — Fernandes, A. & Leitão, M. T. (1984). Contribution a l'étude citotaxonomique des Spermatophyta du Portugal. XVIII. Lamiaceae. Mem. Soc. Brot. 27: 27-75.
GIFT · GIFT (floras)
2n 184×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015 +1
CCDB · ipcn-api-dl — AYDIN, A. 1978. In IOPB chromosome number reports LXI. Taxon 27: 375–392.
CCDB · book-ipcn75-78 — Aydin 1978
CCDB · CromoCat 2015 — Aydin, A. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 375-376.
GIFT · GIFT (floras)
2n 201×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 53×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 608-618. Ruz de Clavijo Jimnez, E.Anales Jard. Bot. Madrid47(2): 425-430(1990).
CCDB · ipcn-api-dl — Ruíz de Clavijo, E. 1990. Números cromosomáticos de plantas occidentales, 608--618. Anales Jard. Bot. Madrid 47: 425–430.
CCDB · CromoCat 2015 — Ruíz de Clavijo Jiménez, E. (1990b). Números cromosomáticos de plantas occidentales, 608-618. Anales Jard. Bot. Madrid 47(2): 425-430.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Baltisberger, M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-889
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.997 ↗
08Occurrence & distribution
Record type49 756 records
Wild obs. + sensor45 913
Museum / vouchered3 766
Cultivated / captive15
Other62
Origin
Native369
Introduced5 260
Range
Area of Occupancy AOO88 788 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy41% within 1 km
≤100 m 9 180≤1 km 8 084≤10 km 24 157>10 km 338
41 759 georeferenced · 4 154 without coordinates
Open the mapobservation + sensor45 913
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 324≤1 km 571≤10 km 687>10 km 82
1 664 georeferenced · 2 102 without coordinates
Open the institutions mapphysical evidence3 766
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 12
12 georeferenced · 3 without coordinates
Open the mapnot free-living15
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions110 of 211 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 365 |
| BIO-UNIPIlocation not on record | 166 |
| MeiseBGlocation not on record | 142 |
| CICYTEXlocation not on record | 134 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 130 |
| Zürich, CH | 118 |
| Zürich, CH | 117 |
| Mount Annan, AU | 98 |
| Brisbane, AU | 93 |
| SLU Artdatabankenlocation not on record | 89 |
| Uppsala, SE | 87 |
| Museo Entomologico de Leonlocation not on record | 65 |
| Adelaide, AU | 64 |
| CJBGlocation not on record | 58 |
| Badajoz, ES | 56 |
| Oskarshamn, SE | 52 |
| ISAlocation not on record | 52 |
| Kensington, AU | 46 |
| Auckland, NZ | 46 |
| BClocation not on record | 44 |
| MAlocation not on record | 43 |
| DBF-NHMDlocation not on record | 38 |
| South Kensington, GB | 37 |
| Canberra, AU | 37 |
| Hobart, AU | 36 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 35 |
| València, ES | 33 |
| Bronx, US | 32 |
| Wellington, NZ | 32 |
| College of the Atlantic, Museumlocation not on record | 29 |
| Córdoba, ES | 28 |
| BFLlocation not on record | 27 |
| BDBClocation not on record | 25 |
| Salamanca, ES | 25 |
| Görlitz, DE | 23 |
| Olocation not on record | 23 |
| Christchurch, NZ | 23 |
| Entomological Society of Latvialocation not on record | 23 |
| Uniwersytet Wrocławskilocation not on record | 22 |
| Madrid, ES | 21 |
| Paris, FR | 18 |
| Frankfurt am Main | 17 |
| Kew, GB | 16 |
| Armidale, AU | 15 |
| Wlocation not on record | 14 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 14 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 14 |
| Blumenau, BR | 14 |
| Castelar, AR | 14 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 13 |
| Saint Louis, US | 13 |
| Vitoria, ES | 13 |
| Sanda, JP | 13 |
| Sevilla, ES | 13 |
| Barcelona, ES | 12 |
| Bern, CH | 12 |
| Nijmegen, NL | 12 |
| Odawara, JP | 11 |
| Rotorua, NZ | 11 |
| Tilburg, NL | 10 |
| John T. Waterhouse Herbariumlocation not on record | 10 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| San Isidro, AR | 10 |
| BISHlocation not on record | 9 |
| Berlin, DE | 9 |
| Brussel, BE | 9 |
| Acadia Universitylocation not on record | 9 |
| Puerto Ayora, EC | 8 |
| Kochi, JP | 8 |
| Corrientes, AR | 8 |
| PUC-RSlocation not on record | 8 |
| Granada, ES | 8 |
| Natural History Museum Rotterdamlocation not on record | 7 |
| Chicago, US | 7 |
| Porrentruy, CH | 7 |
| Philadelphia, US | 7 |
| BSBIlocation not on record | 7 |
| University of Stellenboschlocation not on record | 6 |
| Fulda, DE | 6 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 6 |
| Kagoshima, JP | 6 |
| FUVATESlocation not on record | 6 |
| Universidad de Antioquia (UdeA)location not on record | 6 |
| Arcata, US | 6 |
| WTUlocation not on record | 6 |
| BRNUlocation not on record | 6 |
| Mlocation not on record | 5 |
| Bergen, NO | 5 |
| Honolulu, US | 5 |
| Santa Cruz, US | 5 |
| Turku, FI | 5 |
| Taipei, TW | 5 |
| Trondheim, NO | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| KMNlocation not on record | 4 |
| Dresden, DE | 4 |
| TAIElocation not on record | 4 |
| Jaén, ES | 4 |
| Chapingo, MX | 4 |
| Córdoba, AR | 4 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 4 |
| Regensburgische Botanische Gesellschaftlocation not on record | 4 |
| Vancouver, CA | 4 |
| Jena Microbial Resource Collectionlocation not on record | 4 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 4 |
| UGentlocation not on record | 3 |
| Arequipa, PE | 3 |
| Columbia, US | 3 |
| UIBlocation not on record | 3 |
| Universidad de Nariño (UdeNar)location not on record | 3 |
| Batemans Bay, AU | 3 |
| Smithfield, AU | 3 |
| Pullman, US | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| FUNEDlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| UNESClocation not on record | 3 |
| QVMAGlocation not on record | 3 |
| Ivano-Frankivsk, UA | 3 |
| National Museum Waleslocation not on record | 3 |
| Criciúma, BR | 3 |
| Tsukuba, JP | 3 |
| Sion, CH | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| TROMlocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Palmerston North, NZ | 2 |
| Stockholm, SE | 2 |
| Gijón, ES | 2 |
| Moscow State Universitylocation not on record | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| UFPRlocation not on record | 2 |
| Taipei, TW | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Banyoles, ES | 2 |
| Rishon Le Zion, IL | 2 |
| Wollongong, AU | 2 |
| NSW Office of Environment and Heritagelocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Pretoria, ZA | 2 |
| Xiamen, CN | 2 |
| Bourges, FR | 2 |
| Provincia di Livornolocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| INMAlocation not on record | 1 |
| UFSMlocation not on record | 1 |
| Podgorica, ME | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Philadelphia, US | 1 |
| CPATSAlocation not on record | 1 |
| IAPlocation not on record | 1 |
| DASSHlocation not on record | 1 |
| Oulu, FI | 1 |
| Staten Island, US | 1 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 1 |
| UnBlocation not on record | 1 |
| Madrid, ES | 1 |
| San Diego, US | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Brasília, BR | 1 |
| INBIOlocation not on record | 1 |
| GZUlocation not on record | 1 |
| Cascavel, BR | 1 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 1 |
| Namur, BE | 1 |
| Lake Charles, US | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Pamplona, ES | 1 |
| Corvallis, US | 1 |
| Maringá, BR | 1 |
| FLADlocation not on record | 1 |
| Mexico City, MX | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Lausanne, CH | 1 |
| USP-IBlocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Nagano City, JP | 1 |
| Cape Town, ZA | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| University of Bayreuthlocation not on record | 1 |
| Sendai, JP | 1 |
| Moscow, US | 1 |
| La Paz, BO | 1 |
| H-AkrKGlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| UESBlocation not on record | 1 |
| Tampa, US | 1 |
| UNESP-FCAlocation not on record | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Shanghai, CN | 1 |
| Santa Teresa, BR | 1 |
| Feira de Santana, BR | 1 |
| Santiago de Compostela, ES | 1 |
| UFBAlocation not on record | 1 |
| Minia, EG | 1 |
| Salzburg, AT | 1 |
| UFMSlocation not on record | 1 |
| BGPAlocation not on record | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Salvador, BR | 1 |
| La Trobe Universitylocation not on record | 1 |
| Alicante, ES | 1 |
211 institutions · 3 322 of 3 766 vouchered records shown · 432 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA12 detections
Where the DNA of Stachys arvensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found12
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 12 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.4 °C 2.60–15.9
Seasonal swing summer↔winter14.9 °C
Max temp (day)16.7 °C 5.40–20.5
Min temp (night)10.4 °C 0–13.9
Precipitation73.9 mm/mo 58.3–119
Air humidity64.5 % 57.7–66.1
Moisture balance0.7 mm/mo -34.8–34.7
Vapour deficit511 Pa 252–804
Wind speed4.00 m/s 2.90–5.40
Cloud cover49.9 % 41.2–60.3
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.