Stachys affinis

Bunge · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Stachys

At a glance

Occurrence records24

Data sources12

Biological traits13

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Stachys affinis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionDukesPhytochem · NPASS22 compounds

Occurrence & distributionGBIF24 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB1.4 Gbp

01Narrative

Le crosne ou crosne du Japon est une espèce de plantes à fleurs de la famille des lamiacées. C'est une plante herbacée originaire du Nord-Ouest de la Chine et cultivée pour ses tubercules comestibles. Le terme désigne aussi ses tubercules, parfois consommés comme légumes. C'est l'un des rares légumes de la famille des lamiacées, qui rassemble par ailleurs de nombreuses plantes condimentaires, médicinales et mellifères. Cette plante doit son nom à la ville de Crosne, dans l'Essonne, où elle fut pour la première fois cultivée en France en 1882 par A. Paillieux et D. Bois.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Leaf size360 mm²

Plant height0.044 m

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Specific leaf area (SLA)4.76 mm²/mg

03Chemical composition22 compounds

Compounds documented for Stachys affinis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking💊 Medicinal use documented

Compound class profile5 classes

Guaiane sesquiterpenoids3

Ansa peptide alkaloids2

Betalain alkaloids2

Chromones1

Coumarinolignans1

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,5R,6S,7S,10S,14R,15R,16S,21R)-6,7,16-trihydroxy-1,2,5,8,8,15,20,20-octamethyl-19-oxapentacyclo[12.9.0.02,11.05,10.015,21]tricos-11-ene-18,23-dione	present	NPASS
(2S)-1-[(2E)-2-[(2R)-2,6-dicarboxy-2,3-dihydro-1H-pyridin-4-ylidene]ethylidene]-6-hydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydroindol-1-ium-2-carboxylate	present	NPASS
(2S)-1-[2-[(2S)-2,6-dicarboxy-2,3-dihydro-1H-pyridin-4-ylidene]ethylidene]-6-hydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydroindol-1-ium-2-carboxylate	present	NPASS
(2S)-2-(dimethylamino)-3-methyl-N-[(3S,4S,7S,10Z)-7-(2-methylpropyl)-5,8-dioxo-3-propan-2-yl-2-oxa-6,9-diazabicyclo[10.2.2]hexadeca-1(14),10,12,15-tetraen-4-yl]butanamide	present	NPASS
(2S,3R,4R,5R,6S)-2-[[(1S,2R,3R)-7-hydroxy-1-(4-hydroxy-3-methoxyphenyl)-3-(hydroxymethyl)-6-methoxy-1,2,3,4-tetrahydronaphthalen-2-yl]methoxy]-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3S)-2-(dimethylamino)-N-[(2Z,6S,9S,10S)-6-isobutyl-10-isopropyl-5,8-dioxo-11-oxa-4,7-diazabicyclo[10.2.2]hexadeca-1(14),2,12,15-tetraen-9-yl]-3-methyl-pentanamide	present	NPASS
(6R,8S,8aR)-6-hydroxy-3,8-dimethyl-5-propan-2-yl-6,7,8,8a-tetrahydro-1H-azulen-2-one	present	NPASS
(8S,8aR)-3,8-dimethyl-5-propan-2-yl-1,7,8,8a-tetrahydroazulene-2,6-dione	present	NPASS
(8S,8aR)-5-[(2S)-1-hydroxypropan-2-yl]-3,8-dimethyl-6,7,8,8a-tetrahydro-1H-azulen-2-one	present	NPASS
2-Hexyl-5-hydroxy-7-methoxychromen-4-one	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stachys affinis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR878464.1 ↗306 bpChina

ACGT

GGGGGGCGGCGGGGGCGGAGATTGGCCCCCCGTGCGCAGCGATGCGCGCGGCCGGCCCAAACCCGAATCCGCCGTCGACGCAAGTCGCGA …

Stachys affinis voucher EM620 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Stachys affinis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 395 146 938 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Stachys affinis1.4 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Krestovskaya, T. V. & I. M. Vassiljeva. 1998. Chromosome numbers in some species of the genus Stachys (Lamiaceae). Bot. Žhurn. (Moscow & Leningrad) 83(4): 142.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type24 records

Wild obs. + sensor8

Museum / vouchered8

Cultivated / captive8

Origin

Introduced8

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 1≤10 km 4

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 8

8 georeferenced

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	4
Bronx, US	1
Berlin, DE	1
Bourges, FR	1
Adam Mickiewicz University in Poznańlocation not on record	1

5 institutions · 8 of 8 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Stachys affinis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)