Stachyphrynium placentarium

(Lour.) Clausager & Borchs. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Marantaceae/Stachyphrynium

At a glance

Occurrence records38

Data sources7

Biological traits26

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Stachyphrynium placentarium's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF38 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT≈590 Mbp

01Narrative

Stachyphrynium placentarium is a species of plant in the family Marantaceae. Its basionym was Phyllodes placentaria Lour.de Loureiro J (1790) Fl. Cochinch. 1: 13. and was subsequently long placed as various species in the genus Phrynium. The species is widespread throughout Asia, with records from Bhutan, southern China, India, Indo-China and Indonesia; no subspecies are listed in the Catalogue of Life. The leaves of this species, lá dong, are notably used throughout Việt Nam as a wrapping for food items: especially bánh chưng (the glutinous rice cake consumed at Tết) and bánh tẻ. Species in the similar genus Phrynium, including P. pubinerve may also be used for this purpose.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length12 mm

Fruit length max12 mm

Fruit length min12 mm

Inflorescence length max5 cm

Inflorescence length min3 cm

Leaf length425 mm

Leaf length max550 mm

Leaf length min300 mm

Leaf size85 000 mm²

Leaf width200 mm

Plant height1 m

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max1 100 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry4

Leaf c409 mg/g

Leaf dry-matter content (LDMC)298 mg/g

Leaf n16.75 mg/g

Leaf p4.88 mg/g

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stachyphrynium placentarium has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ869829.1 ↗5 806 bpChina · 2019

ACGT

ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTATTTCAGACTGTGAAACTGC …

Stachyphrynium placentarium isolate L41101 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL9★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Stachyphrynium placentarium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈590 000 000 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Stachyphrynium placentarium0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · Original-count

CCDB · Original-count — Winterfeld, G., Ley, A., Hoffmann, M.H., Paule, J., Röser, M. (2020). Dysploidy and polyploidy trigger strong variation of chromosome numbers in the prayer-plant family (Marantaceae). Pl. Syst. Evol. 306: 36. doi: 10.1007/s00606-020-01663-x

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelscaffold

08Occurrence & distribution

Record type38 records

Wild obs. + sensor5

Museum / vouchered33

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 1>10 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 2≤10 km 8

10 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	15
Bronx, US	6
Kunming, CN	6
F. Borchseniuslocation not on record	2
Moscow State Universitylocation not on record	1
Saint Louis, US	1

6 institutions · 31 of 33 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)