Staavia radiata

(L.) Dahl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Bruniales/Bruniaceae/Staavia

At a glance

Occurrence records1 580

Data sources6

Biological traits19

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Staavia radiata's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 580 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF1 580 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaTgenome

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max1 m

Plant height min0.4 m

Seed mass0.989 mg

⚠ sources differ — TRY: 0.989 mg · GIFT: 0.9 mg

Seed mass max0.9 mg

Seed mass min0.9 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 220 m

Elevation min6 m

Epiphyteterrestrial

Growth formshrub

Mycorrhiza type0.0000000704

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Staavia radiata has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSAY494037.1 ↗600 bp

ACGT

TCGATGCCTACAAAGAAAAACGACTAGCAAACCCATGCGAATCTCGGGGTCAGGGGCCAGGGGCACCCCCTATCCCATCCTCCCACGTCG …

Staavia radiata internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Staavia radiata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 580 records

Wild obs. + sensor1 285

Museum / vouchered295

Range

Area of Occupancy AOO1 212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 082≤1 km 77≤10 km 14>10 km 3

1 176 georeferenced · 109 without coordinates

Open the mapobservation + sensor1 285

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 23≤10 km 29>10 km 2

54 georeferenced · 241 without coordinates

Open the institutions mapphysical evidence295

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	139
Cape Town, ZA	74
Zürich, CH	29
Claremont, US	11
MeiseBGlocation not on record	9
GHPG$location not on record	4
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	4
Vancouver, CA	3
LDlocation not on record	3
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	2
Zürich, CH	2
South African National Biodiversity Institutelocation not on record	2
MSB-3054location not on record	2
Kew, GB	2
Stockholm, SE	1
Cape Town, ZA	1
Philadelphia, US	1
Moscow State Universitylocation not on record	1
Saint Louis, US	1

19 institutions · 291 of 295 vouchered records shown · 4 without an institution code

09Environmental DNA4 detections

Where the DNA of Staavia radiata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Staavia radiata

At a glance

Sources6 archives

Size & morphology5

Life cycle & reproduction3

Diet & foraging1

Habitat & environment9

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 580 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 580 records