Spyridium stenophyllum — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records29

Data sources3

Biological traits9

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Spyridium stenophyllum's data was compiled from.

GBIFGlobal Biodiversity Information Facility29 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF29 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPAusTraits

Life cycle & reproduction4

Dispersal typeanimal+self

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Habitat & environment5

Climatesubtropical

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Woodinesswoody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium stenophyllum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481505.1 ↗6 284 bpAustralia

ACGT

TGTTGGCAGGCTCTGTGCTTGGGCATCGAACTGTTGACCTTCAGCTCATTCAGTGGCTGCTACAAGGACTTGTGCTCCTTGAGGTGTTTT …

Spyridium stenophyllum subsp. renovatum voucher MELUD117717a external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2ITS8

plant barcodefungal barcode

08Occurrence & distribution

Record type29 records

Wild obs. + sensor7

Museum / vouchered22

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 4>10 km 2

6 georeferenced · 1 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 5≤1 km 6≤10 km 10>10 km 1

22 georeferenced

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	12
Adelaide, AU	7
Canberra, AU	3

3 institutions · 22 of 22 vouchered records shown