Spyridium spadiceum

(Fenzl) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records67

Data sources3

Biological traits17

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Spyridium spadiceum's data was compiled from.

GBIFGlobal Biodiversity Information Facility67 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF67 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Plant height1.57 m

Plant height max3 m

Plant height min0.15 m

Seed mass0.61 mg

Seed mass max0.61 mg

Seed mass min0.61 mg

Life cycle & reproduction3

Flowering timeyyyynnnyyyyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Woodinesswoody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium spadiceum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481501.1 ↗6 286 bpAustralia

ACGT

TGTTGGCAGGCTCTGTGCTTGGGCATCGAACTGTTGACCCGCAGCTCCTTCAGTGTTTTGCTACAAGGACTTTGTGCTCCTTGAGTTGTT …

Spyridium spadiceum voucher MELUD117691a external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type67 records

Wild obs. + sensor4

Museum / vouchered62

Cultivated / captive1

Origin

Native2

Introduced1

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 2

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 59

59 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence62

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	34
Kensington, AU	13
Mount Annan, AU	3
LDlocation not on record	3
Canberra, AU	3
Parkville, AU	2
Brisbane, AU	2
Adelaide, AU	1
BGPAlocation not on record	1

9 institutions · 62 of 62 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)