Spyridium phylicoides

Reissek · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records1 267

Data sources3

Biological traits22

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Spyridium phylicoides's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 267 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF1 267 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology6

Fruit length2.5 mm

Leaf length9.5 mm

Leaf width2 mm

Seed mass1.02 mg

Seed mass max1.02 mg

Seed mass min1.02 mg

Life cycle & reproduction6

Dispersal typeanimal+self

Flowering timeyynnnnnnyyyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Habitat & environment7

Climatesubtropical

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelanceolate linear

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium phylicoides has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481472.1 ↗6 279 bpAustralia

ACGT

TGTTGGCAGGCTCTGTGCTTGGGCATCGAACTGTTGACCTTCAGCTCCTTCAGTGGCTGCTACAAGGACTTGTGCTCCTTGAGGTGTTTT …

Spyridium phylicoides voucher MELUD122272a external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type1 267 records

Wild obs. + sensor497

Museum / vouchered770

Origin

Native522

Range

Area of Occupancy AOO2 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 229≤1 km 115≤10 km 120>10 km 9

473 georeferenced · 24 without coordinates

Open the mapobservation + sensor497

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 208≤1 km 193≤10 km 310>10 km 44

755 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence770

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	547
Canberra, AU	70
Museo Entomologico de Leonlocation not on record	56
Mount Annan, AU	7
Brisbane, AU	5
Parkville, AU	4
Kensington, AU	3
Hobart, AU	2
Armidale, AU	2
MAlocation not on record	1
EL PASO, US	1
Wellington, NZ	1

12 institutions · 699 of 770 vouchered records shown · 71 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Spyridium phylicoides

At a glance

Sources3 archives

Size & morphology6

Life cycle & reproduction6

Habitat & environment7

Physiology & chemistry2

Other traits1

At a glance

Record type1 267 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 12 geolocated

Record type1 267 records