Spyridium phlebophyllum

(F.Muell.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records289

Data sources3

Biological traits19

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Spyridium phlebophyllum's data was compiled from.

GBIFGlobal Biodiversity Information Facility289 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF289 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPTRYAusTraits

Size & morphology3

Fruit length3 mm

Leaf length11 mm

Seed mass0.952 mg

Life cycle & reproduction6

Dispersal typeanimal+self

Flowering timeyyyyyyyyyyyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Habitat & environment7

Climatedesert or dry shrubland

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeoblong obovate ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium phlebophyllum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481471.1 ↗6 285 bpAustralia

ACGT

TGTTGGCAGGCTCTGTGCTTGGGCATCGAACTGTTGACCTGCAGCTCCTTCAGTGTTTGCTATAAGGACTTTGTGCTCCTTGAGGTGTTT …

Spyridium phlebophyllum voucher MELUD122296a external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type289 records

Wild obs. + sensor68

Museum / vouchered221

Origin

Native77

Range

Area of Occupancy AOO624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 27≤1 km 9≤10 km 8

44 georeferenced · 24 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 18≤1 km 60≤10 km 110>10 km 23

211 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence221

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	154
Canberra, AU	20
Museo Entomologico de Leonlocation not on record	18
Mount Annan, AU	6
Brisbane, AU	3
Armidale, AU	3
Kew, GB	2
EL PASO, US	1
Parkville, AU	1
Claremont, US	1

10 institutions · 209 of 221 vouchered records shown · 12 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)