Spyridium obovatum

(Hook.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records532

Data sources3

Biological traits13

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Spyridium obovatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility532 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF532 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology5

Leaf length20 mm

Leaf size188 mm²

Leaf width12 mm

Plant height15 m

Seed mass0.615 mg

⚠ sources differ — TRY: 0.615 mg · AusTraits: 0.727 mg

Life cycle & reproduction2

Life spanperennial

Sex typehermaphrodite+monoecious

Habitat & environment6

Climatetemperate

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium obovatum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481460.1 ↗6 283 bpAustralia

ACGT

TGTTGGCAGGCTCTGTGCTTGGGCATCGAACTGTTGACCTGCAGCTCCTTCAGTGTCTGCTATAAGGAACTTTGTGCTCCTTGAGGTGTT …

Spyridium obovatum var. velutinum voucher MELUD122307a 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS7

plant barcodefungal barcode

08Occurrence & distribution

Record type532 records

Wild obs. + sensor365

Museum / vouchered167

Origin

Native5

Range

Area of Occupancy AOO988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 193≤1 km 33≤10 km 107>10 km 13

346 georeferenced · 19 without coordinates

Open the mapobservation + sensor365

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 1≤1 km 104≤10 km 29>10 km 7

141 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence167

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	99
Museo Entomologico de Leonlocation not on record	16
Canberra, AU	15
QVMAGlocation not on record	13
Parkville, AU	6
Mount Annan, AU	5
Adelaide, AU	5
Wellington, NZ	4
Brisbane, AU	2
Stockholm, SE	1
Auckland, NZ	1

11 institutions · 167 of 167 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)