Spyridium obcordatum

(Hook.fil.) W.M.Curtis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records106

Data sources3

Biological traits12

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Spyridium obcordatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility106 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF106 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology4

Leaf length10 mm

Leaf width6 mm

Plant height0.4 m

Seed mass0.471 mg

Life cycle & reproduction2

Life spanperennial

Sex typehermaphrodite+monoecious

Habitat & environment6

Climatetemperate

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium obcordatum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481454.1 ↗6 287 bpAustralia

ACGT

TGTTGGCAGGCTCTGTGCTTGGGCATCGAACTGTTGACCTGCAGCTCCTTCAGTGTTTGCTATAAGGACTTTGTGCTCCTTGAGGTGTTT …

Spyridium obcordatum voucher MELUD117626a external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type106 records

Wild obs. + sensor54

Museum / vouchered52

Origin

Native4

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 46≤1 km 4≤10 km 2>10 km 2

54 georeferenced

Open the mapobservation + sensor54

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 1≤1 km 19≤10 km 15>10 km 3

38 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	18
Museo Entomologico de Leonlocation not on record	7
Canberra, AU	7
QVMAGlocation not on record	6
Mount Annan, AU	4
Parkville, AU	3
Adelaide, AU	3
MAlocation not on record	1
Kensington, AU	1
Brisbane, AU	1
Wellington, NZ	1

11 institutions · 52 of 52 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)