Spyridium microcephalum

(Turcz.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records134

Data sources3

Biological traits22

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Spyridium microcephalum's data was compiled from.

GBIFGlobal Biodiversity Information Facility134 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF134 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Plant height0.8 m

Plant height max1.5 m

Plant height min0.1 m

Seed mass0.51 mg

Seed mass max0.51 mg

Seed mass min0.51 mg

Life cycle & reproduction8

Dispersal typeanimal+self

Flowering timennyyyyyyyyyy

Life formsubshrub

Life spanperennial

Lifespan years6 years

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Woodinesswoody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium microcephalum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481440.1 ↗6 283 bpAustralia

ACGT

TGTTGGCAGGCTCTGTGCTTGGGCATCGAACTGTTGACCTGCAGCTCCTTCAGTGTTTTGCTACAAGGACTTTGTGCTCCTTGAGTTGTT …

Spyridium microcephalum voucher MELUD122289a external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type134 records

Wild obs. + sensor11

Museum / vouchered123

Origin

Native5

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 6≤10 km 2

8 georeferenced · 3 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 32≤1 km 16≤10 km 50>10 km 2

100 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	86
Canberra, AU	14
Adelaide, AU	6
Mount Annan, AU	5
Museo Entomologico de Leonlocation not on record	4
BGPAlocation not on record	4
Parkville, AU	3
Brisbane, AU	1

8 institutions · 123 of 123 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)