Spyridium leucopogon

(Reissek) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records122

Data sources3

Biological traits15

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Spyridium leucopogon's data was compiled from.

GBIFGlobal Biodiversity Information Facility122 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF122 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesTRYAusTraitsWCVP

Size & morphology3

Leaf length4.5 mm

Leaf width0.625 mm

Seed mass0.412 mg

Life cycle & reproduction4

Dispersal typeanimal+self

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Habitat & environment7

Climatesubtropical

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapestrap-shaped

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium leucopogon has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481433.1 ↗6 282 bpAustralia

ACGT

TGTTGGCAGGCTCTGTGCTTGGGCATCGAACTGTTGACCTTCAGCTCCTTCAGTGGCTGCTACAAGGACTTGTGCTCCTTGAGGTGTTTT …

Spyridium leucopogon voucher AD272772 external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type122 records

Wild obs. + sensor31

Museum / vouchered91

Origin

Native32

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 21≤1 km 6≤10 km 3

30 georeferenced · 1 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 12≤1 km 27≤10 km 42>10 km 6

87 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	50
Museo Entomologico de Leonlocation not on record	16
Canberra, AU	12
Mount Annan, AU	6
QVMAGlocation not on record	1
Hobart, AU	1
EL PASO, US	1

7 institutions · 87 of 91 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)