Spyridium halmaturinum

F.Muell. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records438

Data sources7

Biological traits20

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Spyridium halmaturinum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility438 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF438 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Spyridium halmaturinum, commonly known as Kangaroo Island spyridium, is a species of flowering plant in the family Rhamnaceae and is endemic to Kangaroo Island in South Australia. It is an erect, sticky shrub with densely softly-hairy young stems, leaves that are heart-shaped with the narrower end towards the base to broadly wedge-shaped or Y-shaped, and dense heads of white to cream-coloured flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology8

Fruit length3 mm

Leaf length10 mm

Leaf width4 mm

Plant height max1.5 m

Plant height min1 m

Seed mass0.555 mg

⚠ sources differ — TRY: 0.555 mg · AusTraits: 0.526 mg · GIFT: 0.56 mg

Seed mass max0.56 mg

Seed mass min0.56 mg

Life cycle & reproduction4

Dispersal typeanimal+self

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Habitat & environment7

Climatesubtropical

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeoblong obtriangular

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium halmaturinum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences9

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY911582.1 ↗664 bp

ACGT

ACTGGGGGAGGATCATTGTCGAACCCTGCCAGAACAACCCGCGAACCCGTAAAAAGAAATTTGGGGGGCTTCGGGGCCTTAGGCCTCGGG …

Spyridium halmaturinum 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type438 records

Wild obs. + sensor189

Museum / vouchered248

Cultivated / captive1

Origin

Native149

Introduced23

Range

Area of Occupancy AOO780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 76≤1 km 55≤10 km 38>10 km 11

180 georeferenced · 9 without coordinates

Open the mapobservation + sensor189

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 19≤1 km 71≤10 km 123>10 km 25

238 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence248

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	180
Museo Entomologico de Leonlocation not on record	33
Canberra, AU	11
Mount Annan, AU	10
EL PASO, US	2
Parkville, AU	2
Hobart, AU	2
Kensington, AU	1
Christchurch, NZ	1
LDlocation not on record	1

10 institutions · 243 of 248 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Spyridium halmaturinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)