Spyridium furculentum

W.R.Barker & Kellermann · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records545

Data sources4

Biological traits19

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Spyridium furculentum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility545 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF545 records

DNA & barcodingNCBIsequences

01Narrative

Spyridium furculentum, commonly known as forked spyridium, is a species of flowering plant in the family Rhamnaceae and is endemic to a small area of Victoria in Australia. It is a shrub with softly-hairy young stems, Y-shaped leaves, and head of white to cream-coloured flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsWCVPGIFT

Size & morphology5

Fruit length2.5 mm

Leaf length10 mm

Leaf width2 mm

Plant height1.6 m

Plant height max1.6 m

Life cycle & reproduction6

Dispersal typeanimal+self

Flowering timennnnnnyyyyyn

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Habitat & environment6

Climatesubtropical

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium furculentum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481420.1 ↗6 283 bpAustralia

ACGT

TGTTGGCAGGCTCCGTGCTTGGGCATCGAACTGTTGACCTTCAGCTCATTCAGTGGCTGCTACAAGGACTTGTGCTCCTTGAGGTGTTTT …

Spyridium furculentum voucher MELUD122313a external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type545 records

Wild obs. + sensor504

Museum / vouchered41

Origin

Native2

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 487≤1 km 7≤10 km 6>10 km 1

501 georeferenced · 3 without coordinates

Open the mapobservation + sensor504

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 7≤1 km 12≤10 km 12>10 km 3

34 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	23
Adelaide, AU	7
Kensington, AU	2
Mount Annan, AU	2
Berlin, DE	2
Bronx, US	1
Kew, GB	1
Wlocation not on record	1
South Kensington, GB	1
Canberra, AU	1

10 institutions · 41 of 41 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)