Spyridium daltonii

(F.Muell.) Kellermann · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records162

Data sources5

Biological traits24

DNA specimens0

eDNA detections1

Sources5 archives

Databases and archives Spyridium daltonii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility162 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF162 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Spyridium daltonii is a species of flowering plant in the family Rhamnaceae and is endemic to Victoria in Australia. It is a shrub with softly-hairy branchlets, linear to narrowly elliptic leaves, and small groups of hairy, yellowish flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length3 mm

Leaf length10 mm

Leaf width1 mm

Plant height3 m

Plant height max3 m

Plant height min0.8 m

Seed mass1.6 mg

Seed mass max1.6 mg

Seed mass min1.6 mg

Life cycle & reproduction6

Dispersal typeanimal+self

Flowering timennnnyyyyynnn

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Habitat & environment7

Climatesubtropical

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear narrowly_elliptical

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium daltonii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences8

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY911598.1 ↗615 bp

ACGT

CGACCCTTGCCTAGCAGAACGACCCGCGAACCCGTAAAAAAAAATATCGGGGGGCTTCGGGGCCTTAGGCCTCGTGCTTTCCTGGTCGGG …

Trymalium daltonii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type162 records

Wild obs. + sensor69

Museum / vouchered93

Origin

Native7

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 17≤1 km 17≤10 km 21>10 km 3

58 georeferenced · 11 without coordinates

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 8≤1 km 21≤10 km 29>10 km 14

72 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence93

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	51
Adelaide, AU	13
Mount Annan, AU	8
Canberra, AU	8
Brisbane, AU	4
Parkville, AU	3
Hobart, AU	3
Wellington, NZ	1
Smithfield, AU	1
Palmerston, AU	1

10 institutions · 93 of 93 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Spyridium daltonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)