Spyridium coactilifolium

Reissek · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records238

Data sources4

Biological traits21

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Spyridium coactilifolium's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility238 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF238 records

DNA & barcodingNCBIsequences

01Narrative

Spyridium coactilifolium, commonly known as butterfly spyridium, is a species of flowering plant in the family Rhamnaceae. It has white-velvety flowers and oval shaped leaves that are thickly covered in soft hairs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology5

Fruit length2.5 mm

Leaf length10.5 mm

Seed mass0.57 mg

Seed mass max0.57 mg

Seed mass min0.57 mg

Life cycle & reproduction6

Dispersal typeanimal+self

Flowering timeyynnnnnnnnny

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Habitat & environment7

Climatesubtropical

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeoblong ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium coactilifolium has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481401.1 ↗6 286 bpAustralia

ACGT

TGTTGGCAGGCTCCGTGCTTGGGCATCGAACTGTTGACCTTCAGCTCATTCAGTGGCTGCTACAAGGACTTGTGCTCCTTGAGGTGTTTT …

Spyridium coactilifolium voucher MELUD122276a external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type238 records

Wild obs. + sensor99

Museum / vouchered138

Cultivated / captive1

Origin

Native78

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 37≤1 km 32≤10 km 5>10 km 1

75 georeferenced · 24 without coordinates

Open the mapobservation + sensor99

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 6≤1 km 45≤10 km 69>10 km 6

126 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence138

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	99
Museo Entomologico de Leonlocation not on record	17
Mount Annan, AU	4
Hobart, AU	3
Parkville, AU	3
EL PASO, US	2
MAlocation not on record	2
Taipei, TW	1
Kensington, AU	1
MeiseBGlocation not on record	1
Auckland, NZ	1
Canberra, AU	1

12 institutions · 135 of 138 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)