Spyridium cinereum

N.A.Wakef. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records219

Data sources4

Biological traits31

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Spyridium cinereum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility219 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF219 records

DNA & barcodingNCBIsequences

01Narrative

Spyridium cinereum, commonly known as tiny spiridium, is a species of flowering plant in the family Rhamnaceae and is endemic to south-eastern continental Australia. It is a low-lying shrub with heart-shaped leaves, the narrower end towards the base, and heads of whitish, shaggy-hairy flowers with brown bracts at the base of the heads.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology11

Fruit length2.5 mm

Leaf length8 mm

Leaf length max8 mm

Leaf length min4 mm

Leaf width5 mm

Leaf width max5 mm

Leaf width min3 mm

Plant height0.2 m

Plant height max0.5 m

Plant height min0.1 m

Seed mass0.308 mg

Life cycle & reproduction6

Dispersal typeanimal+self

Flowering timennnnnnnnyynn

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeobcordate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium cinereum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481399.1 ↗6 287 bpAustralia

ACGT

TGTTGGCAGGCTCCGTGCTTGGGCATCGAACTGTTGACCTGCAGCTCCTTCAGTGTTTGCTGTAAGGACTTTGTGCTCCTTGAGGTGTTT …

Spyridium cinereum voucher MELUD117683a external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type219 records

Wild obs. + sensor131

Museum / vouchered88

Origin

Native10

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 86≤1 km 19≤10 km 20

125 georeferenced · 6 without coordinates

Open the mapobservation + sensor131

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 24≤1 km 27≤10 km 20>10 km 5

76 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	38
Canberra, AU	17
Mount Annan, AU	9
La Trobe Universitylocation not on record	7
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Adelaide, AU	4
Parkville, AU	3
Hobart, AU	2
Kew, GB	2
Stockholm, SE	1
Wellington, NZ	1

11 institutions · 88 of 88 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)